1. Welcome to Religious Forums, a friendly forum to discuss all religions in a friendly surrounding.

    Your voice is missing! You will need to register to get access to the following site features:
    • Reply to discussions and create your own threads.
    • Our modern chat room. No add-ons or extensions required, just login and start chatting!
    • Access to private conversations with other members.

    We hope to see you as a part of our community soon!

Featured Scientists create living eating and growing machines...

Discussion in 'Evolution Vs. Creationism' started by Dell, Apr 21, 2019.

  1. Dell

    Dell Asteroid insurance?

    Joined:
    Apr 12, 2017
    Messages:
    282
    Ratings:
    +118
    Religion:
    Atheist
    • Informative Informative x 5
    • Like Like x 1
  2. Brickjectivity

    Brickjectivity Veteran Member
    Staff Member Premium Member

    Joined:
    Dec 8, 2012
    Messages:
    25,639
    Ratings:
    +8,095
    Religion:
    Liberal Christian
  3. sayak83

    sayak83 Well-Known Member
    Staff Member Premium Member

    Joined:
    May 7, 2012
    Messages:
    8,572
    Ratings:
    +8,031
    Religion:
    Pluralist Hindu
    A science news article that forgets to refer to the actual published paper is very irritating.
     
    • Like Like x 4
  4. Hockeycowboy

    Hockeycowboy Well-Known Member
    Premium Member

    Joined:
    Oct 28, 2015
    Messages:
    5,520
    Ratings:
    +3,173
    Religion:
    Christian
    Yippee!
     
    • Funny Funny x 1
  5. Subduction Zone

    Subduction Zone Veteran Member

    Joined:
    Nov 7, 2017
    Messages:
    27,669
    Ratings:
    +15,377
    Religion:
    Atheist
    • Informative Informative x 3
    • Like Like x 2
  6. Jollybear

    Jollybear Hey

    Joined:
    Jan 11, 2010
    Messages:
    4,445
    Ratings:
    +554
    Religion:
    Christian/mystic
    • Funny Funny x 3
  7. KenS

    KenS Well-Known Member

    Joined:
    Sep 3, 2013
    Messages:
    7,960
    Ratings:
    +2,124
    Religion:
    Judeo/Christian
    hmmmm... Intelligent design.
     
  8. Darkstorn

    Darkstorn This shows how unique i am.

    Joined:
    Feb 5, 2013
    Messages:
    1,681
    Ratings:
    +1,139
    No it doesn't. At best it "proves" that intelligence could create or design life.

    The leaps you Discovery pawns make are sometimes grossly hilarious.
     
    • Like Like x 5
    • Winner Winner x 4
  9. Jollybear

    Jollybear Hey

    Joined:
    Jan 11, 2010
    Messages:
    4,445
    Ratings:
    +554
    Religion:
    Christian/mystic
    Well that still tips it toward evidence of intelligence more so then none intelligence creating life, lol
     
  10. Darkstorn

    Darkstorn This shows how unique i am.

    Joined:
    Feb 5, 2013
    Messages:
    1,681
    Ratings:
    +1,139
    No it doesn't. At the VERY best it makes the old Creationist argument "well, you can't create life from non-life!" even more nonsensical than it always was. I.E It's implying *humans* CAN create life in the lab.

    Let it sink in. Humans creating life in a lab. That's all it "proves." And even then i'd say it's not conclusive yet. A good start.

    Oh and even better: It blurs the line between robotics and biology. They might end up being one and the same in the future.
     
    • Like Like x 1
    • Winner Winner x 1
  11. Cleary

    Cleary God is sovereign and in control <><

    Joined:
    Apr 11, 2019
    Messages:
    137
    Ratings:
    +44
    Religion:
    christian
    scientists-create-living-eating-and-growing-machines

    Riiiight !!!! .... If scientists created living-eating-and-growing-machines, the WHO created the scientists ? hmmm ??
     
  12. Darkstorn

    Darkstorn This shows how unique i am.

    Joined:
    Feb 5, 2013
    Messages:
    1,681
    Ratings:
    +1,139
    Living-eating-and-growing-humans gave birth to those scientists.
     
    • Like Like x 3
  13. Jollybear

    Jollybear Hey

    Joined:
    Jan 11, 2010
    Messages:
    4,445
    Ratings:
    +554
    Religion:
    Christian/mystic
    Your simply making excuses.

    If scientists made life in the lab, then it proves that intelligence can create life.

    Its simple.
     
  14. Darkstorn

    Darkstorn This shows how unique i am.

    Joined:
    Feb 5, 2013
    Messages:
    1,681
    Ratings:
    +1,139
    You're projecting.

    Yes, but it doesn't prove your chosen intelligence actually exists. It ONLY proves that HUMANS can create life in a lab. Nothing else. You're employing wishful thinking.

    Too complex for you.
     
    • Like Like x 1
    • Winner Winner x 1
  15. Cleary

    Cleary God is sovereign and in control <><

    Joined:
    Apr 11, 2019
    Messages:
    137
    Ratings:
    +44
    Religion:
    christian
    Indeed .... ONLY intelligence can create life ....

    binary code (10010010110101101001001010101) .... or

    Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac - upto 4 billion per cell)

    [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG]
     
  16. Jollybear

    Jollybear Hey

    Joined:
    Jan 11, 2010
    Messages:
    4,445
    Ratings:
    +554
    Religion:
    Christian/mystic
    No, your denying.

    Proving and evidence are different. Its evidence that intelligence creates life.

    Too logical for you.
     
  17. Bob the Unbeliever

    Bob the Unbeliever Well-Known Member

    Joined:
    Mar 19, 2017
    Messages:
    6,522
    Ratings:
    +4,023
    Religion:
    unbeliever
    Oh.... dear. Such a collection of deliberate and maliciously misleading material I have not seen in months.

    I suppose if the Lie is for Jesus, then it's okay? And not, in fact, False Witness?
     
    • Like Like x 2
    • Winner Winner x 1
  18. Darkstorn

    Darkstorn This shows how unique i am.

    Joined:
    Feb 5, 2013
    Messages:
    1,681
    Ratings:
    +1,139
    I am denying your accusation and making a counter claim that it is you who is giving excuses. As in, you're projecting.



    There's some evidence that intelligence can create life. You're the one that said it *proves* your particular chosen intelligence. I'm saying your version is not proven.

    Let's pretend your wishful thinking corresponds to reality.
     
    • Like Like x 1
  19. Cleary

    Cleary God is sovereign and in control <><

    Joined:
    Apr 11, 2019
    Messages:
    137
    Ratings:
    +44
    Religion:
    christian
    nothing to be proven wrong here ?? .... display how DNA code is not code but rather random 'sequence' ??
     
    • Funny Funny x 1
  20. Jollybear

    Jollybear Hey

    Joined:
    Jan 11, 2010
    Messages:
    4,445
    Ratings:
    +554
    Religion:
    Christian/mystic
    It proves scientists create life.

    Its evidence only intelligence creates life.
     
Loading...