1. Welcome to Religious Forums, a friendly forum to discuss all religions in a friendly surrounding.

    Your voice is missing! You will need to register to get access to the following site features:
    • Reply to discussions and create your own threads.
    • Our modern chat room. No add-ons or extensions required, just login and start chatting!
    • Access to private conversations with other members.

    We hope to see you as a part of our community soon!

Featured Scientists create living eating and growing machines...

Discussion in 'Evolution Vs. Creationism' started by Dell, Apr 21, 2019.

  1. Dell

    Dell Asteroid insurance?

    Apr 12, 2017
    • Informative Informative x 5
    • Like Like x 1
  2. Brickjectivity

    Brickjectivity Telescopic Toes
    Staff Member Premium Member

    Dec 8, 2012
    Liberal Christian almost quaker
  3. sayak83

    sayak83 Well-Known Member
    Staff Member Premium Member

    May 7, 2012
    Pluralist Hindu
    A science news article that forgets to refer to the actual published paper is very irritating.
    • Like Like x 4
  4. Hockeycowboy

    Hockeycowboy Well-Known Member
    Premium Member

    Oct 28, 2015
    • Funny Funny x 1
  5. Subduction Zone

    Subduction Zone Veteran Member

    Nov 7, 2017
    • Like Like x 2
    • Informative Informative x 2
  6. Jollybear

    Jollybear Hey

    Jan 11, 2010
    • Funny Funny x 3
  7. KenS

    KenS Well-Known Member

    Sep 3, 2013
    hmmmm... Intelligent design.
  8. Darkstorn

    Darkstorn This shows how unique i am.

    Feb 5, 2013
    No it doesn't. At best it "proves" that intelligence could create or design life.

    The leaps you Discovery pawns make are sometimes grossly hilarious.
    • Like Like x 5
    • Winner Winner x 4
  9. Jollybear

    Jollybear Hey

    Jan 11, 2010
    Well that still tips it toward evidence of intelligence more so then none intelligence creating life, lol
  10. Darkstorn

    Darkstorn This shows how unique i am.

    Feb 5, 2013
    No it doesn't. At the VERY best it makes the old Creationist argument "well, you can't create life from non-life!" even more nonsensical than it always was. I.E It's implying *humans* CAN create life in the lab.

    Let it sink in. Humans creating life in a lab. That's all it "proves." And even then i'd say it's not conclusive yet. A good start.

    Oh and even better: It blurs the line between robotics and biology. They might end up being one and the same in the future.
    • Like Like x 1
    • Winner Winner x 1
  11. Cleary

    Cleary God is sovereign and in control <><

    Apr 11, 2019

    Riiiight !!!! .... If scientists created living-eating-and-growing-machines, the WHO created the scientists ? hmmm ??
  12. Darkstorn

    Darkstorn This shows how unique i am.

    Feb 5, 2013
    Living-eating-and-growing-humans gave birth to those scientists.
    • Like Like x 3
  13. Jollybear

    Jollybear Hey

    Jan 11, 2010
    Your simply making excuses.

    If scientists made life in the lab, then it proves that intelligence can create life.

    Its simple.
  14. Darkstorn

    Darkstorn This shows how unique i am.

    Feb 5, 2013
    You're projecting.

    Yes, but it doesn't prove your chosen intelligence actually exists. It ONLY proves that HUMANS can create life in a lab. Nothing else. You're employing wishful thinking.

    Too complex for you.
    • Like Like x 1
    • Winner Winner x 1
  15. Cleary

    Cleary God is sovereign and in control <><

    Apr 11, 2019
    Indeed .... ONLY intelligence can create life ....

    binary code (10010010110101101001001010101) .... or

    Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac - upto 4 billion per cell)

    [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG] [​IMG]
  16. Jollybear

    Jollybear Hey

    Jan 11, 2010
    No, your denying.

    Proving and evidence are different. Its evidence that intelligence creates life.

    Too logical for you.
  17. Bob the Unbeliever

    Bob the Unbeliever Well-Known Member

    Mar 19, 2017
    Oh.... dear. Such a collection of deliberate and maliciously misleading material I have not seen in months.

    I suppose if the Lie is for Jesus, then it's okay? And not, in fact, False Witness?
    • Like Like x 1
    • Winner Winner x 1
  18. Darkstorn

    Darkstorn This shows how unique i am.

    Feb 5, 2013
    I am denying your accusation and making a counter claim that it is you who is giving excuses. As in, you're projecting.

    There's some evidence that intelligence can create life. You're the one that said it *proves* your particular chosen intelligence. I'm saying your version is not proven.

    Let's pretend your wishful thinking corresponds to reality.
    • Like Like x 1
  19. Cleary

    Cleary God is sovereign and in control <><

    Apr 11, 2019
    nothing to be proven wrong here ?? .... display how DNA code is not code but rather random 'sequence' ??
    • Funny Funny x 1
  20. Jollybear

    Jollybear Hey

    Jan 11, 2010
    It proves scientists create life.

    Its evidence only intelligence creates life.