Scientists create living eating and growing machines...

[Bob the Unbeliever]

No, your denying..

Nope-- his point was quite accurate. And denying is all that is needed-- when proof is missing, such as with the claim "god is real" <-- where's the proof? No? Okay, then-- DISMISSED.

Proving and evidence are different. Its evidence that intelligence creates life.
.

Not quite accurate: it's evidence that evidence can create life. Be we already knew this: Sex between two intelligent humans, can indeed, create life.

But. Life can also be created by non-intelligent organisms having sex-- or not-having-sex, but simple binary fusion. Or several combinations of the two: Bacteria are quite good at combining exchange of DNA and binary fusion, to create **new** species of bacteria.

For a given meaning of the word "species"-- as bacteria don't follow the usual rules with respect to species' boundaries.... they seem to ignore such things, creating new species all the time: PROOF? A constant need to update anti-bacterial medicines...

Too logical for you.

Oh. Dear. You used the word "logic" in a way that is entirely inconsistent with the standard meaning.

 

[Darkstorn]

It proves scientists create life.

Its evidence only intelligence creates life.

You're just plain wrong. Nothing indicates that ONLY intelligence creates life. There is no evidence. There is wishful thinking and outright lies but that's all we've gotten from you.

 

[Bob the Unbeliever]

nothing to be proven wrong here ?? .... display how DNA code is not code but rather random 'sequence' ??

DNA is not code-- not now YOU mean (understand) the word.

Neither is it a Blue Print.

DNA is very complicated-- but it's hard to describe how and why, because DNA is entangled with Epigenetics, which switch the main DNA codes on and off, depending on the situation-- sometimes from millisecond to millisecond.

For example: You could search DNA forever, and you would NEVER-EVER find "code" that describes a person's fingerprints. Or the pattern of their retina or irises. Or even the pattern of the freckles on their skin. None of these traits is coded for in any DNA, anywhere. Yet-- here they are-- every human has unique fingerprints, retina and iris patterns.

These are emergent properties. Not specifically "coded" for in DNA.

 

[Bob the Unbeliever]

It proves scientists create life.

Its evidence only intelligence creates life.

Nope. Not even close--- bacteria create life every second of every day-- more than any other organism on the planet, in fact.

 

[Cleary]

Nothing indicates that ONLY intelligence creates life

indeed, DNA the atheist's kryptonite .... DNA: the tiny code that's toppling evolution

 

[Jollybear]

You're just plain wrong. Nothing indicates that ONLY intelligence creates life. There is no evidence. There is wishful thinking and outright lies but that's all we've gotten from you.

You're just plain wrong. Nothing indicates that non intelligence creates life. There is no evidence. There is wishful thinking and outright lies but that's all we've gotten from you

 

[Jollybear]

Nope. Not even close--- bacteria create life every second of every day-- more than any other organism on the planet, in fact.

What are bacteria and how do they create life? Go ahead.

 

[Bob the Unbeliever]

Back to the OP:

Scientists have created a material that seems to mimic the self-organizational properties of DNA, but is not, in fact, DNA.

Which is pretty cool.

It quickly reminds me of the countless examples of "ANDROIDS" in Literature-- fully artificial life-forms that are not based on DNA, but are easily as complicated as DNA based life.

The "synthetic beings" trope in Science Fiction.

Brilliant!

It also paves the way for another trope: Fully synthetic replacement organs, to repair ailing humans.

If this new self-replicating material is not toxic to DNA based life, but can exist along side it, or even embedded within DNA life?

It could possibly lead to fully synthetic replacement organs: Imagine a fully synthetic replacement heart, but one that is 100% not rejected, and doesn't require immune-suppression drugs so common with the current heart replacement methods?

Iaasic Asimov wrote a short story, many decades ago, that featured a Choice for a heart patient: A fully synthetic, but biological replacement heart, that got it's energy directly from the patent's own bloodstream, or a fully mechanical heart, that used one of Asimov's "black box" Atomic Power Packs. The surgeon in question was, of course, one of Asimov's Humanoid Robots-- and the scene ends, with the surgeon sterilizing his hands, by placing them into a very high temperature oven ... titanium alloy not being affected by the heat in the least...

I have always been fascinated by fully synthetic DNA-like molecules, and their potential.

Imagine a biological computing machine? One that ran on..... Coke or Pepsi (or any other sugar solution, with negligible trace elements).

"Oh, crap, my iPhone 23 is hungry again. We need to stop a buy it a Coke."

"What? I thought you fed your phone just an hour ago?"

"I did-- but you know that streaming in 16K hologram video eats up the battery, and besides, we only have 87 bars signal out here in the Grand Canyon."

"Yeah, it's so Primitive out here-- I'll text Amazon, and they'll send a flying drone in about an hour-- I have Hourly Prime after all-- may as well use it."

"Use it or waste it, they say. Hey, did you hear Jeff Bezos is going for his 10th full body rebuild?"

"No! He's so vain-- the old body wasn't even a week old!"

"I know, right?"

 

[Bob the Unbeliever]

In order for the atheist to gain any credibility ...
The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < no can do

.... this is why the FOOL hath said in his heart: "there is no God"

Patience folks .... Bob the Unbeliever < consults his advisors

Well... if even a FOOL can see the OBVIOUS that gods are made up for the gullible and the under-educated?

A WISE MAN would shout it from a mountaintop. Right?

 

[Bob the Unbeliever]

What are bacteria and how do they create life? Go ahead.

"Do you ever have a problem where you just don't know how to reply to an argument, not because you don't know the answer, but you just don't know where to begin? Like, the foundation of knowledge you'd need to impart to this person before you could even begin to drag them out of their sinkhole of ignorance would cost thousands of dollars if it were coming from a university?"

 

[Cleary]

Well... if even a FOOL can see the OBVIOUS that gods are made up for the gullible and the under-educated?

A WISE MAN would shout it from a mountaintop. Right?

In order for the atheist to gain any credibility ...
The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < no can do < the challenge still stands

 

[tas8831]

Your simply making excuses.

If scientists made life in the lab, then it proves that intelligence can create life.

Its simple.

So I guess all those creationist requests for evidence are just disingenuous acts of dishonesty... Got it.

 

[Darkstorn]

You're just plain wrong. Nothing indicates that non intelligence creates life. There is no evidence. There is wishful thinking and outright lies but that's all we've gotten from you

This is what I mean when I accuse you of lying. This is not true.

 

[tas8831]

Indeed .... ONLY intelligence can create life ....

binary code (10010010110101101001001010101) .... or

Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac - upto 4 billion per cell)

Polychaos dubium = 670 billion. I guess an amoeba is the favored creation?

 

[Darkstorn]

In order for the atheist to gain any credibility ...
The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < no can do < the challenge still stands

What do you think this thread is about? such evidence exists right here in this very thread (it's the very subject of this thread.)

It's about scientists creating life from "non-life." I'm willing to say it's not conclusive. But it's better than you hand waving it.

 

[tas8831]

In order for the atheist to gain any credibility ...
The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < no can do < the challenge still stands

Show me where creationists have re-created the act of making a man from dust? No can do? No credibility.

 

[Jollybear]

This is what I mean when I accuse you of lying. This is not true.

It is true. Theres no evidence non intelligence creates life.

 

[tas8831]

In order for the atheist to gain any credibility ...
The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < no can do

.... this is why the FOOL hath said in his heart: "there is no God"

Patience folks .... Bob the Unbeliever < consults his advisors

And the theist gets to sit back and do nothing, relying on false dichotomies, special pleading, and begging the question.

So cool to be a theist and not have to think at all.

 

[Cleary]

And the theist gets to sit back and do nothing, relying on false dichotomies, special pleading, and begging the question.

The atheist needs to preform / demonstrate / display how life arrived from non-life ie: matter alone < the challenge stands

 

[Darkstorn]

It is true. Theres no evidence non intelligence creates life.

You're wrong. Sticking your fingers into your eye sockets does not change reality.