Proof Against Evolution

[Fluffy]

This is survival of the fittest, natural selection.
What you should be proving is natural randomness, not natural selection.

Mutation is not survival of the fittest nor natural selection. Mutation is one of the mechanisms through which natural selection is able to happen. You are right that the article I posted did indicate that natural selection was happening here. However, I only wished to use it to show you that mutation happens.

Whilst evolution is not as simple as mutation+environmental pressure, a lot of it can be attributed to this process. Therefore, if mutation can be shown not to happen, it would totally crush evolutionary theory. I felt it an important enough mechanism to provide evidence for.

You should know that random has two distinct meanings. It can be used to mean something that has a possibility of having two or more distinct outcomes. This type of randomness is currently only supported by quantum physics.

The type of random used in evolution is used to imply a lack of design. For example, if I shuffled a deck of cards and drew the top 5, I would call it a random hand. I would not be implying that the person who had previously played with the deck had had zero affect on that hand. I would simply mean that there had been no intelligent control of the result.

Given this, natural selection is random so I fail to see the distinction you are trying to make.

Mutation, which evolutionists frequently hide behind, is not a magic wand that transforms living organisms into a more advanced and perfect form.

Evolution is not a ladder, the term "evolutionists" is attributed to those who combine creationism and evolution and scientists specifically state there there is selection for negative mutation as well as positive mutation.

One of the most important discoveries of the twentieth century was the discovery of the DNA molecule. It has had a powerful effect on biological research. It has also brought quandary and confusion to evolutionary scientists.

Firstly you should know that an appeal to authority is a logical fallacy. If evolution is correct then it is correct regardless of how confused scientists are. Secondly, this is an incorrect appeal to authority since it implies that scientists (ie at least the majority) are confused when the statistics indicate the exact opposite:
Project Steve

DARWIN ON THE ORIGIN OF THE SPECIES—

The battle over evolutionary theory finds its center in the species. This is where *Charles Darwin attempted to fight it, but without success. Even though he called his first book by that name, he never did try to figure out the origin of the species.

"Darwin never really did discuss the origin of the species in his Origin of the Species."—*Niles Eldredge, Time Frames: The Rethinking of Darwinian Evolution and the Theory of Punctuated Equilibria, (1985), p. 33.

Darwin doesn't need to do anything of the sort. Again this is an appeal to authority. Hippocrates never tried to perform a triple heart bypass therefore such procedures are impossible?

*Darwin could not figure out why species even existed. If his theory was correct, there would be no distinct species, only confused creatures everywhere and no two alike.

What do you mean by "confused creatures"? Indicate precisely how Darwin's theory showed that there would be no distinct species and only "confused creatures".

"Charles Darwin, himself the father of evolution in his later days, gradually became aware of the lack of real evidence for his evolutionary speculation and wrote: ‘As by this theory, innumerable transitional forms must have existed. Why do we not find them embedded in the crust of the earth? Why is not all nature in confusion instead of being, as we see them, well defined species?"—H. Enoch, Evolution or Creation (1966), p. 139.

To answer the question posed by Darwin:

Some of the reasons for the incompleteness of fossil records are:

• In general, the probability that an organism becomes fossilized after death is very low;
• Some species or groups are less likely to become fossils because they are soft-bodied;
• Some species or groups are less likely to become fossils because they live (and die) in conditions that are not favourable for fossilization to occur in;
• Many fossils have been destroyed by land movements and erosion;
• Some fossil remains are complete, but most are fragmentary;
• Some evolutionary change occurs in populations at the limits of a species' ecological range, and as these populations are likely to be small, the probability of fossilization is lower (see punctuated equilibrium);
• Similarly, when environmental conditions change, the population of a species is likely to be greatly reduced, such that any evolutionary change induced by these new conditions is less likely to be fossilized;
• Most fossils convey information about external form, but little about how the organism functioned;
• Using present-day biodiversity as a guide, this suggests that the fossils unearthed represent only a fraction of the large number of species of organisms that lived in the past.

 

[Fluffy]

To make the situation worse, *Darwin did not know of one instance in which a species changed into another.

You are assuming that there is only one brand of evolution. It would be a bit like assuming that there had only been one model for a heliocentric solar system and then accusing Galileo of getting it wrong because Copernicus had failed to produce the necessary evidence.

I have already provided you with evidence of observed speciation so I do not know what more you want.

ORIGIN OF THE SPECIES UNKNOWN—(*#1/27 Origin of the Species Unknown / #2/13 The Experts are Puzzled*) The problem of species has become a major unsolved problem of the evolutionists, because they cannot figure out where they came from.
"More biologists would agree with Professor Hampton Carson of Washington University, St. Louis, when he says that speciation is ‘a major unsolved problem of evolutionary biology.’ "—*G.R. Taylor, Great Evolution Mystery (1983), p. 141.
"In the last thirty years or so speciation has emerged as the major unsolved problem. The British geneticist, William Bateson, was the first to focus attention on the question. In 1922 he wrote: ‘In dim outline evolution is evident enough. But that particular and essential bit of the theory of evolution which is concerned with the origin and nature of species remains utterly mysterious.’ Sixty years later we are if anything worse off, research having only revealed complexity within complexity."—*G.R. Taylor, Great Evolution Mystery (1983), p. 140.

Perhaps that is true. Have you gone through and discounted each instance of observed speciation? How do you explain these instances of observed speciation?

Evolutionists point to changes WITHIN the species and call that "microevolution," and then proceed to tell us that such sub-species changes prove that theorized changes ACROSS species (which they term "macroevolution") must also be occurring.

That is not true. You are again speaking of Darwinism and not modern evolutionary synthesis.

A simulation will only tell you you what in reality you tell it.
These are inaccurate and biased simulations, not approved by creationists & evolutionists alike. A flawed design will always give a flawed outcome.
If the parameters input, and program code can be accepted & verified by evolutionist & creationists, and then agree to accept whatever the outcome. This would be better and unbiased simulaton. But I doubt very much that will ever happen, due to the fact that the model (code & data) will always conflict.

I largely agree. However, it is not really a necessary piece of the puzzle, just supportive evidence.

EVIDENCE OF EVOLUTION—If evolution was a fact, we should find in present events and past records abundant evidence of one species changing into another species.

Here ya go: http://en.wikipedia.org/wiki/Horse_evolution

But, throughout all past history and in present observations, no one has ever seen this happen.

I have provided you with direct facts, of which you requested, that documented observed instances of speciation.

Prior to written history, we only have fossil evidence. Scientists all over the world have been collecting and studying fossils for over a hundred years. Literally millions have been collected!

Ahhh are you perhaps suggesting that because we cannot go back an observe each step of evolutionary process it must therefore not have happened? Let me put it to you another way: We have not directly observed that gravity was causing apples to fall from trees thousands of years ago. Does this mean that gravity does not exist?

 

[JerryL]

"universal_brother",

Your posts do not represent your own thoughts. They are presenting funsamentally erronious poitions and you've made no attempt to actually interact when they have been discussed.

In short, you are not engaged in a discussion, merely using RF as a forum to paste whatever articles you feel like. I will not be participating until and unless you would like to actually have a discussion.

 

[universal_brother]

You should know that random has two distinct meanings. It can be used to mean something that has a possibility of having two or more distinct outcomes. This type of randomness is currently only supported by quantum physics.

The type of random used in evolution is used to imply a lack of design. For example, if I shuffled a deck of cards and drew the top 5, I would call it a random hand. I would not be implying that the person who had previously played with the deck had had zero affect on that hand. I would simply mean that there had been no intelligent control of the result.

Given this, natural selection is random so I fail to see the distinction you are trying to make.

Fluffy, how did you go from explaining randomness in a deck of cards,
to calling natural selection random.

You're saying natural selection is synonymous with the randomness of shuffled cards?

If we use the metaphor "Survival of the fittest" for Natural Selection you'll have a better understanding of what I'm saying, or what you are saying!

"Given this, natural selection is random"
=Given this, Survival of the Fittest is Random!!

Randon > Top 5 from Shuffled Cards > Survival Of The Fittest

The fittest cards survived under this analogy.
Does this make sense to you?
If this is not what you're saying then please re-address, or give a different analogy.

 

[Jayhawker Soule]

You're saying natural selection is synonymous with the randomness of shuffled cards?

Natural selection is the effect, or unintended consequence, of pseudo-random variation.

 

[universal_brother]

Natural selection is the effect, or unintended consequence, of pseudo-random variation.

Then would you say Natural Selection is Natural Randomness?
Or the unintended consequence of Natural Randomness?

How can total randomness select only which is better, and move only in advantageous directions? Random occurrences do not work that way.

 

[universal_brother]

Here ya go: http://en.wikipedia.org/wiki/Horse_evolution
I have provided you with direct facts, of which you requested, that documented observed instances of speciation.

The following list comprises of counter arguments against Horse evolution, which I totally agree with. Horse evolution is indeed carefully fabricated, and then used in textbooks as if they were verified/confirmed Facts. They have too many discrepencies to be anything remotely factual.

Evolution Facts - Horses

1 - Different animals in each series.
2 - Imaginary, not real.
3 - Number of rib bones.
4 - No transitional teeth.
5 - Not from in-order strata.
6 - Calling a badger a horse.
7 - Horse series exists only in museums.
8 - Each one distinct from others.
9 - Bottom found at the top.
10 - Gaps below as well as above.
11 - Recent ones below earlier ones.
12 - Never found in consecutive strata.
13 - Heavily keyed to size.
14 - Bones an inadequate basis.

 

[JerryL]

Which part is being disputed?

Mutation changes gene-sequence.
Genes determine morphology.
Genetic changes are passed from parent to child through inheritence.
Morphologies which are better suited to survival will survive more often than ones less suited.

OK. There's evolution in a nut-shell. Which part would anyone like to assert is wrong?

 

[painted wolf]

I'm sorry Univeral Brother but your website is filled with errors.

Eohippus (hyracotherium) is not a rodent, it is nothing like a rodent and posseses none of the markers for being a rodent. Not in its teeth (the biggest marker) not in its legs, feet or spine... and on and on.
take a look:
rodent skull (notice the teeth in particular)
http://www.science-art.com/gallery/82/82_824200314210.jpg
http://www.evolutionnyc.com/ImgUpload/P_453837_961871.jpg
Hyracotherium (eohippus) http://www.researchcasting.ca/images/hyracotherium vasacciense-3D skull-AMNH 4832.psd.jpg
Now for the Hyrax who has only the most superficial resemblance to either a rodent or a Hyracotherium (eohippus):
http://www.skulls-skeletons.com/catalog/images/CA-23252S-Tree-Hyrax.jpg

1: the diffence is due to the fact that evolution doesn't move in a stright line and the hose liniage has several side branches.
2: huh? I hope they aren't mistaking the south american Litopterna for horses.
3: speiceis are not nessisarily direct liniage...
4: Parahippus has transitional teeth between browsers and grazers.
5: Example?
6: Hyrax is not a badger nor is Hyracotherium... its name means "Hyrax-Like" because it has a very superficial resemblance to this elephant cousin. But it isn't a Hyrax nor is it anything like a badger. (come to think of it a Hyrax is nothing like a badger so calling it a "rock badger" makes about as much sence as "jumbo shirmp")
http://www.flmnh.ufl.edu/fhc/hyraco1.htm
7: Acutally most fossil horses are from the US
Hyracotherium (eohippus): Western USA and Europe
Orohippus: wyoming
Mesohippus: colorado
Miohippus: western USA/Florida
Parahippus: Great Plains/Florida USA
Merychippus: USA
Pliohippus: USA/Canada
Dinohippus: USA/Canada
Equis: worldwide (except antarctica/austrailia) (equis includes asses, zebra, onager and horses)
8: uh huh.... this gets into the red herring of the "missing link"
9:citation please? Equis is found from 5 million years ago Hyracotherium from 55-45 Mya.
10: Gaps... hmmm we havent found everything yet... nuts.
11: right... I think they are mistaking the Litopterna for horses. :bonk: This is also the red herring of "why are there still monkeys?"
12: North America.
13: the size variation in modern horses is due to human genetic tinkering. Wild species of horse are roughtly the same size. Some prehistoric species were larger than the modern Equis by the way such as Dinohippus and Equis giganteus some smaller like modern Equis hemionus (onager) Zebra, Horse, Donkey and Onager are all different sizes.
14: um, yes we can tell the difference between a zebra, horse, donkey and onager from thier skeletons.
And yes they are placed together in Equis.

In short your source isn't very accurate and highly misleading.
check out Fossil Horses in Cyberspace for more accurate information: http://www.flmnh.ufl.edu/fhc/firstCM.htm

Next paleontology question if you please... I've missed this :jiggy:

wa:do

 

[Fluffy]

Fluffy, how did you go from explaining randomness in a deck of cards,
to calling natural selection random.

Natural selection happens because those who are the fittest are the most likely to survive. Since they survive longer, they will produce more offspring. Since genetic traits are passed on to offspring, there is a greater chance of the genetic traits of those who are fit (including those that make them fit) becoming more apparent.

There is no guarantee that this will happen, it is just more likely. Since this is the case, you would also expect a smaller percentage of neutral and negative traits to prosper but you would also expect a greater percentage of positive traits to prosper.

There is no overall direction or plan to these changes... each change is independent of every other and although they can be seen to conform to a generalisation, this generalisation does not govern them. Therefore these changes can be said to be random.

 

[Random]

Mutation changes gene-sequence.
Genes determine morphology.
Genetic changes are passed from parent to child through inheritence.
Morphologies which are better suited to survival will survive more often than ones less suited.

OK. There's evolution in a nut-shell. Which part would anyone like to assert is wrong?

None, that works for me just fine.

 

[Real Sorceror]

:highfive: You guys r teh smart! I mean wow!
Universal Brother, this is what we call "pwn3d".

 

[Yerda]

How can total randomness select only which is better, and move only in advantageous directions?

You need to understand that selection is not random.

 

[Yerda]

Mutation changes gene-sequence.
Genes determine morphology.
Genetic changes are passed from parent to child through inheritence.
Morphologies which are better suited to survival will survive more often than ones less suited.

Very well said.

 

[logician]

"You need to understand that selection is not random."

No, but geological processes that can affect evolution are, such as meteor or comet strikes, floods, hurricanes, earthquakes, drought which causes famine, etc.

 

[Yerda]

"You need to understand that selection is not random."

No, but geological processes that can affect evolution are, such as meteor or comet strikes, floods, hurricanes, earthquakes, drought which causes famine, etc.

Yes. Are they relevant however?

 

[Jayhawker Soule]

Then would you say Natural Selection is Natural Randomness? Or the unintended consequence of Natural Randomness?

How can total randomness select only which is better, and move only in advantageous directions? Random occurrences do not work that way.

Randomness select nothing. Randomness leads to random variation, many of which result in the death of the host. A few are inheritable and beneficial, and the resulting offspring preferentially contribute to the gene pool.

 

[universal_brother]

Which part is being disputed?

Mutation changes gene-sequence.

Thats obvious, and it's extremely rare that it would be positive change.
Please refer to my post 78 on Mutation and it's real effects.

Genes determine morphology.

The Creator has a common design, no transitions. Thats not proof of evolution, what you need is proof of species change! A transition.

Genetic changes are passed from parent to child through inheritence.

Inheritance, why state the obvious? That again is not evolution.
Thats genetic inheritance!! Is this a transitional species change?
Anyway, because of the limits imposed by this genome or gene pool, it is impossible for one species to change into another species.
And without species change, there can be no evolution!

Morphologies which are better suited to survival will survive more often than ones less suited.

OK. There's evolution in a nut-shell. Which part would anyone like to assert is wrong?

In order for evolution to occur, the mammoth hurdle of the DNA code barrier would have to be somehow surmounted. Quite obviously, accidental changes and random events could never accomplish the needed task.

When something is written for little people, they are called fairy stories, but when prepared for big people, they are called "the frontiers of evolutionary science."

OK. There's evolution in a nut-shell.

 

[universal_brother]

:highfive: You guys r teh smart! I mean wow!
Universal Brother, this is what we call "pwn3d".

:seesaw:

 

[JerryL]

Genes determine morphology

The Creator has a common design, no transitions. Thats not proof of evolution, what you need is proof of species change! A transition.

Are you disputing that genes determine morphology?

Anyway, because of the limits imposed by this genome or gene pool, it is impossible for one species to change into another species. And without species change, there can be no evolution!

We have a positive claim here on your part. Of course, you carry the burden of proof, but since proving your claim false is so easy... some observed instances of speciation:

Goatsbeard ("Three species of wildflowers called goatsbeards were introduced to the United States from Europe shortly after the turn of the century. Within a few decades their populations expanded and began to encounter one another in the American West. Whenever mixed populations occurred, the specied interbred (hybridizing) producing sterile hybrid offspring. Suddenly, in the late forties two new species of goatsbeard appeared near Pullman, Washington. Although the new species were similar in appearance to the hybrids, they produced fertile offspring. The evolutionary process had created a separate species that could reproduce but not mate with the goatsbeard plants from which it had evolved.")

Two strains of Drosophila paulistorum developed hybrid sterility of male offspring between 1958 and 1963. Artificial selection induced strong intra-strain mating preferences. (Test for speciation: sterile offspring and lack of interbreeding affinity.) Dobzhansky, Th., and O. Pavlovsky, 1971. "An experimentally created incipient species of Drosophila", Nature 23:289-292

Rapid speciation of the Faeroe Island house mouse, which occurred in less than 250 years after man brought the creature to the island. (Test for speciation in this case is based on morphology. It is unlikely that forced breeding experiments have been performed with the parent stock.) Stanley, S., 1979. Macroevolution: Pattern and Process, San Francisco, W.H. Freeman and Company. p. 41

Formation of five new species of cichlid fishes which formed since they were isolated less than 4000 years ago from the parent stock, Lake Nagubago. (Test for speciation in this case is by morphology and lack of natural interbreeding. These fish have complex mating rituals and different coloration. While it might be possible that different species are inter-fertile, they cannot be convinced to mate.) Mayr, E., 1970. Populations, Species, and Evolution, Massachusetts, Harvard University Press. p. 348

page 22 of the February, 1989 issue of Scientific American. It's called "A Breed Apart." It tells about studies conducted on a fruit fly, Rhagoletis pomonella, that is a parasite of the hawthorn tree and its fruit, which is commonly called the thorn apple. About 150 years ago, some of these flies began infesting apple trees, as well. The flies feed an breed on either apples or thorn apples, but not both. There's enough evidence to convince the scientific investigators that they're witnessing speciation in action. Note that some of the investigators set out to prove that speciation was not happening; the evidence convinced them otherwise.

Of course, you've already asserted that lie (post #75) and I've already refuted it by showing you observed examples of it happening (post #76). Why are you repeating it when you've never defended it?

In order for evolution to occur, the mammoth hurdle of the DNA code barrier would have to be somehow surmounted. Quite obviously, accidental changes and random events could never accomplish the needed task.

Another positive claim. I look forward to you even defining it.

What mammoth hurdle is that? Please describe it from a genetic standpoint.

Given the following DNA sequence, what change cannot occur and why not:
GATTATCTTAGTCTTGAGAGCT

When something is written for little people, they are called fairy stories, but when prepared for big people, they are called "the frontiers of evolutionary science."

Really? I thought they gave it names like "Holy book". But this is pure rhetoric, please support any of your assertions with actual facts.