Truth: either God exists or He don't.

[Pilgrim Soldier]

Of course it is not billions. He just insulted billions of Christians there. Being a Christian does not mean that one is a creationist.

You can't be a Christian and not believe in God. God just happens to be a Creationist

 

[Subduction Zone]

Have you forgotten that spiritual things are invisible? I mean, the wind is invisible but it will slam into you and send you flying through the air like a rag doll.
This is also true of spirits, one single angel killed 186.000 Assyrian soldiers. So don't underestimate the spiritual realm, it's infinitely more powerful and wise than puny humans could ever be

Sorry, but we do not even know if "spiritual things" exist. When people have made claims they have always failed to produce. And the wind is testable even if we cannot see it. Real things we can test and confirm. Imaginary things, not so much.

It is rather amazing that a spirit could kill exactly 186 soldiers (How does one kill a fraction of a soldier?). Where is the reliable source that makes this claim.

 

[Pilgrim Soldier]

You keep asserting that you have this '100% proof' (which is actually impossible, even in principle, for that sort of question), yet you have never even posted even the slightest hint of any evidence, let alone proof. Where is it?

Go and look in the mirror then come back and tell me that you're just a bunch of cosmic dust which randomly came together to form you for no reason at all

 

[Subduction Zone]

You can't be a Christian and not believe in God. God just happens to be a Creationist

I never claimed that you could be a Christian and not believe in God (though that is debatable). Being a Christian does not mean that one has to believe all of the myths of the Bible. And no, God is not a "creationist". You do not even know what a creationist is. The term is relatively recent and the person that invented the term gets to set its meaning. A creationist is someone that denies science to support his mythical beliefs. Specifically the mythical belief of the biblical creation story. Creationists did not exist until after Darwin developed his theory. Darwin was the first person to use that term. "Creation" existed but not "creationist".

 

[SalixIncendium]

Go and look in the mirror then come back and tell me that you're just a bunch of cosmic dust which randomly came together to form you for no reason at all

Well, you wouldn't be. You'd merely be a reflection of that dust.

 

[Subduction Zone]

Go and look in the mirror then come back and tell me that you're just a bunch of cosmic dust which randomly came together to form you for no reason at all

Evolution is not "random" it only appears that way to the uneducated. Your so called "proof" fails.

 

[ratiocinator]

You can't be a Christian and not believe in God. God just happens to be a Creationist

Ah, no true Scotsman fallacy. Plenty of Christians would give you an argument. There are certainly not billions of Christian YECs.

 

[ratiocinator]

Go and look in the mirror then come back and tell me that you're just a bunch of cosmic dust which randomly came together to form you for no reason at all

And another straw man fallacy. That is not what science claims. Evolution is not something that's random and happens for no reason. You are basically bearing false witness - perhaps not deliberately but you are making statements about science that are simply untrue. You can correct that through educating yourself or by stopping making statements about things you don't understand.

 

[Pilgrim Soldier]

How can I be blindly following myself if I am investigating what other people have to say? That is the OPPOSITE of blindly following yourself.

And here is the thing: changing your mind is a GOOD thing. Because it prevents someone from stubbornly believing a falsehood for the rest of their life.

Your faith is blind and you blindly follow what you cannot prove. Your idea of a personal relationship is an emotional crutch. It is just feelings. It is the same thing that all those claiming to be Christians say.

You have set yourself up as the ultimate authority in the universe. You believe that only you have the capacity and ability to decipher whats true and whats false.
Now before you disagree please hear me out. You say that you listen to what everyone else has to say then you draw your own conclusion conditionally of course. You admit that you don't know what's true and false so you go with your feelings, which can change in a moment of madness.
The bottom line here is, you have set yourself up as the final authority on all things,. In other words you are your own god.

 

[Pilgrim Soldier]

And what is your evidence for this claim?

My evidence is, many experts have purchased ancient and antique artefacts believing them to be genuine only to discover that they were fooled by a con artist.

 

[Subduction Zone]

My evidence is, many experts have purchased ancient and antique artefacts believing them to be genuine only to discover that they were fooled by a con artist.

So no evidence at all and no proof at all.

You would make yourself a better debater if you learned what is and what is not evidence.

 

[Pilgrim Soldier]

So have all the many verses wherein Jesus promises that the Son of man would come in the clouds come true?

is all I can say to that. What you really mean is 'what YOU consider' to be an error or a contradiction.
I am sure many people can find 'what they consider' errors and contradictions in the Bible.

I see, so you think I'm using the scientific method to prove my case. Nah, I don't use the old subjective method of circular reasoning. I'll leave that to the pseudo scientists, they have mastered the art.

 

[Subduction Zone]

You have set yourself up as the ultimate authority in the universe. You believe that only you have the capacity and ability to decipher whats true and whats false.
Now before you disagree please hear me out. You say that you listen to what everyone else has to say then you draw your own conclusion conditionally of course. You admit that you don't know what's true and false so you go with your feelings, which can change in a moment of madness.
The bottom line here is, you have set yourself up as the final authority on all things,. In other words you are your own god.

No, this is projection on your part. What we can do is to test ideas and see if they hold water. If a person is too afraid to even test his ideas that person's ideas can be safely ignored. A person that has a true belief in his ideas wants to see them tested. If one does not want to test one's ideas then that belief is rather shaky to say the least.

 

[Subduction Zone]

I see, so you think I'm using the scientific method to prove my case. Nah, I don't use the old subjective method of circular reasoning. I'll leave that to the pseudo scientists, they have mastered the art.

And you still do not know what circular reasoning is. Others have pointed out that that is what you do so you falsely accuse others of that.. Naughty naughty, and also a breaking of the Ninth Commandment.

 

[Polymath257]

Have you forgotten that spiritual things are invisible? I mean, the wind is invisible but it will slam into you and send you flying through the air like a rag doll.

But you can measure wind speed. You can cool it until it liquefies or solidifies and see the result. It reacts chemically and we can measure that.

it is only invisible to our eyes, not to our methods.

This is also true of spirits, one single angel killed 186.000 Assyrian soldiers. So don't underestimate the spiritual realm, it's infinitely more powerful and wise than puny humans could ever be

Any evidence outside of a book of myths?

 

[Pilgrim Soldier]

Sorry, but we do not even know if "spiritual things" exist. When people have made claims they have always failed to produce. And the wind is testable even if we cannot see it. Real things we can test and confirm. Imaginary things, not so much.

It is rather amazing that a spirit could kill exactly 186 soldiers (How does one kill a fraction of a soldier?). Where is the reliable source that makes this claim.

Sorry the number of soldiers killed in one night by an angel is 185,000 not 186,000 what's 1000 soldiers between friends.
You can read all about it in Isaiah 37:36

Just because you haven't encountered a Demon or Angel doesn't mean that they don't exist. Many of us have had physical contact with them. But don't worry, you will eventually have to deal with them whether you like it or not.

 

[Polymath257]

I'm actually saying your methods are fine and reliable, the only problem is the matter you're examining doesn't conform to the laws that you have placed upon it. The matter was created to appear as something it's not so the problem is not with the dating method it's with the subject being examined. The subject matter is not what it appears to be so there in lies the problem

Is this not simply denying the evidence? Why would I suspect that this sort of consistency is not actually valid? Simply because someone *claims* it was 'made to look old'?

OK, how do you *test* the theory that it was 'made to look old'? In particular, how would we show it to be *wrong* if it is? You proposed it, now substantiate it.

 

[Pilgrim Soldier]

No, this is projection on your part. What we can do is to test ideas and see if they hold water. If a person is too afraid to even test his ideas that person's ideas can be safely ignored. A person that has a true belief in his ideas wants to see them tested. If one does not want to test one's ideas then that belief is rather shaky to say the least.

But you don't have the special instrument to examine the evidence, so your examination is useless without the required instrument

 

[Pilgrim Soldier]

And you still do not know what circular reasoning is. Others have pointed out that that is what you do so you falsely accuse others of that.. Naughty naughty, and also a breaking of the Ninth Commandment.

You say I can't produce evidence to support what I believe, but I did present Covid19 and you told me you couldn't see it so it must not exist. That way you win, (in your own mind).

 

[Suave]

Well it depends which God, first.

This being God who is an intelligent creator of life. The euplotid nuclear code is the genetic code used by Euplotidae. The euplotid code is a symmetrical code, resulting from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. Patterns are there fitting the criteria of an intelligent signal.


The code
AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code

DNA codons RNA codons This code (10)
Standard code (1)
TGA UGA Cys (C)
STOP = Ter (*)