A simple case for intelligent design

[Subduction Zone]

Again for the 20th time

The point that i made was that one can accept the BB even if you don't know what mechanism cause it.

So please next time make a relevant coment where you explain why do you agree or disagree with that point.

Your point is wrong. You do not seem to understand why the BB is accepted. For the same reason that the BB is accepted we must reject your beliefs.

My comments are always relevant. You are merely complaining because you either do not understand them or resent them if you do. They demonstrate why you are incorrect.

 

[Subduction Zone]

Ok I made a mistake, I thought my point was clear and that it was obvious that my comment on the BB was sarcasm

So with that said, my point is and has always been that :

You can stablish that "X" is the cause of "Y" even if you don't know the mechanism used by X

Do you grant this point?

No, your comment on the BB was ignorance.

 

[Bear Wild]

I don't see why is this a "fundamental problem"

For example it could be that God tunned the environment such that organisms would receive the correct mutations in the intedebd place and time. Such that humans would eventually evolve

Or it could be that organisms evolve mainly by natural mechanisms with some divine interventions every know and then

Or it could be that God set the correct initial conditions such that humans would eventually evolve

I don't claim to have evidence for any of these, but I don't see why is this a fundamental problem. There are many ways in which a designer could intervine.



Why not,? Elaborate an argument, provide your premises.... How do you go from some animals go extinct to therefore I'd us wrong?

Why is that a fundamental problem, please elaborate an argument

Being unable to explain anything about how things happen is a fatal flaw for ID. If you do not have any evidence, what makes the claim believable. There are so many more questions ID creates with no answers. Can you answer these question?
1. How exactly does god tune the environment and is god now heating up the earth?.
2. How does god actually change the dna constantly using divine interventions all of the time in all dna in every creature or just visiting every now an then for fine tuning?
3. If god is changing the dna can we find evidence of brand new sequences unlike anything that has occurred before?
4. Can we see any evidence that any intelligent is currently active.
5. Which intelligent designer. Which god or which goddess has the most influence or are aliens behind this.
6. What were the initial conditions you are suggesting for humans?
7. Did the ID designer make so many mistakes considering all of the organisms that have become extinct.
8. EXPLAIN HOW THE DESIGNER INTERVINES WITH EVIDENCE NOT JUST I WANT TO BELIEVE IT SO IT MUST BE TRUE.

The list of impossible questions that arise are staggering with no evidence of the action. Compare that to the few yet explained findings in evolution theory which requires no magical activity to explain how life changes. No wonder the ID promotors only look for flaws in evolutions since they know there is no evidence to explain how ID would actually work.

 

[TagliatelliMonster]

If all you need is a single deletion then by definition it can’t be IC nor CSI

Right, which undermines the entire Dembski case in context of DNA.
Clearly IC/CSI is not an indicator in case of DNA.

What surprises me is that Both Behe and Demski (and I) have explicitly manifest that such examples can be a product of “non design”

Which renders your "method" of detecting design, useless.

so I have no idea why would someone argue that such exampls falsify Behe or Demski.

Because it shows that the method doesn't work.

All this shows is that you don’t understand the argument which means that you are in no position to claim that they are wrong.

What it shows, is that the "method" doesn't work.

See, here's the implication.... building on that DNA example, now you can say this, because you know that a single mutation added function. If however you didn't know about it, and just encountered the secand sample, then your "method" WOULD conclude design.

What it shows, is that it argues from ignorance.

You have no objective test that yields positive evidence. You only have negative evidence in the form of "we don't know how it can come about naturally". And then you call it "designed".

Try to make an effort and try to actually understand the argument

I am. I keep asking for clarifications left and right. And all you are doing is further confirm my suspicions of it being just opinion coupled with arguing from ignorance / incredulity.

, rather than trying to find holes and weaknesses in the semantics, .. If you what to refute the argument, try to refute the actual point, rather than the semantics.

The example @tas8831 provided, is not mere "'semantics". It's a practical example of you method failing.

 

[TagliatelliMonster]

The point that I made is that not knowing the mechanism that caused the BB does not invalidates the theory.....

And his point is that the BB theory makes testable prediction that can be independently and objectively tested. While ID does not.

 

[TagliatelliMonster]

I simply made the point that you don't need to know the mechanism in irdet to accept the BB theory.

...because there is objective verifiable positive evidence in support of BB theory.

 

[leroy]

Your point is wrong..

You are literally implying that the BB should be rejected on the basis that we don't know what mechanism caused it.

 

[leroy]

Being unable to explain anything about how things happen is a fatal flaw for ID. If you do not have any evidence, what makes the claim believable. There are so many more questions ID creates with no answers. Can you answer these question?
1. How exactly does god tune the environment and is god now heating up the earth?.
2. How does god actually change the dna constantly using divine interventions all of the time in all dna in every creature or just visiting every now an then for fine tuning?
3. If god is changing the dna can we find evidence of brand new sequences unlike anything that has occurred before?
4. Can we see any evidence that any intelligent is currently active.
5. Which intelligent designer. Which god or which goddess has the most influence or are aliens behind this.
6. What were the initial conditions you are suggesting for humans?
7. Did the ID designer make so many mistakes considering all of the organisms that have become extinct.
8. EXPLAIN HOW THE DESIGNER INTERVINES WITH EVIDENCE NOT JUST I WANT TO BELIEVE IT SO IT MUST BE TRUE.

The list of impossible questions that arise are staggering with no evidence of the action. Compare that to the few yet explained findings in evolution theory which requires no magical activity to explain how life changes. No wonder the ID promotors only look for flaws in evolutions since they know there is no evidence to explain how ID would actually work.

As I said before. I don't know how the designer did it. I have no answer to that question.

What you have to do is justify your asertion and explain why is that a mayor flaw of the argument.

As I said before, not knowing how the pyramids where built does not invalidate the claim that the pyramids where designed.

 

[leroy]

Which renders your "method" of detecting design, useless.

Well elaborate an argument and justify your asertion.

See, here's the implication.... building on that DNA example, now you can say this, because you know that a single mutation added function. If however you didn't know about it, and just encountered the secand sample, then your "method" WOULD conclude design.

That's why you have to know a few things before applying the test. Like the starting point, how many things do you have to change to move from "a" to "b" how many possible combinations are there, how many probabilistic resources you have etc.

 

[leroy]

...because there is objective verifiable positive evidence in support of BB theory.

Granted, and not knowing the mechanism that caused the "Bang" does not invalidate the theory agree?

 

[tas8831]

Specified after the fact, then.

I don’t know what you mean, but if I were to bet, I’ll say that you are putting words in my mouth

If I were going to put words in your mouth, they would not be so confused.

You wrote:

"Something can be specified but not designed."

If something is not designed, then it is not 'pre'-specified, that is, not designed. But how do you know an object of interest (i.e., already made in some way) is "specified"? You have to simply declare it to be, or you have to assess it somehow.

That is, you determine whether or not something was 'specified' after the fact; i.e., you do not actually know if it was specified until you claim that it is.

So, not putting words in your mouth, rather, following your words to their logical conclusion.

In the same way you would measure the probabilistic resources in any other circumstance. You just have to answer to this question “how many chances/tries” do you have? Someone who play the lottery 1 time has less probabilistic resources than someone who plays 100 times.

And yet there are people who have won the lottery on their first try, while people who spend a large percentage of their disposable income on lottery tickets every week have never won and will never win, so yeah, great argument.

Of course, that really doesn't answer my question. Or in a way, I guess it does.

We observe a gene in an extant creature. it is 1500 bases long.

Creationists want to make it seem that it had to have been designed... how to do this? The tired old argument from awe is passe... got to find something new...

I know! Most of the population is math-averse... so lets use numbers! Hmmmm.... So this gene is 1500 bases long... there are 4 bases to pick from... So lets say the odds of this gene coming together all at once is 4^1500 - WOW! that is a HUGE number! We will then declare that therefore, no natural process could have put those 1500 bases in that order to make a gene all at once by chance!

Impresses the pew warmers, to be sure. Heck - you even come up with some 'new' technobabble.

Then someone that understands both evolution and genetics points out...

'Wait - that is not how evolution works. Nobody said that a whole genes comes into existence all at once by chance. In fact, we do know that most genes are parts of gene families, i.e., their sequences are just slight variations on a theme, and are thus not bound by these silly claims about 'probabilistic resources' and such.'

Golly - what is a desperate creationist to do now?

'Oh, uh, well, you are misrepresenting the argument.. yeah, thats it... You're... um... putting words in my mouth! You... um.. are forgetting the big numbers! The specification! The CSI! The probabilistic resources! Doodly!'

 

[TagliatelliMonster]

Well elaborate an argument and justify your asertion.

I you didn't know about the deleterious mutation, nore the ancestral genetic sequence, and thus just be confronted with the "complex & functional" sequence, then that sequence would satisfy the criteria of "specified complexity" and likely even "irreducible complexity".

That's why you have to know a few things before applying the test.

But you don't know about what you don't know.
This is a second reason why the method fails and is useless....

If you don't know about mutations, then you don't know that you don't know about them....

Like the starting point, how many things do you have to change to move from "a" to "b" how many possible combinations are there, how many probabilistic resources you have etc.

But you don't know about what you don't know....
If you don't know about mutations, then you can't even ask the above question.

And let's be serious here, the whole reason why Dembski and his ID cohorts came up with this, was to be able to say that life is created and not of natural origins.

But lo and behold, what process is currently unknown? Ow yes: how life can form.
Who's to say you're not just in the situation as with the DNA example, while not knowing about mutations nore how DNA really works?

Like I said: without this knowledge, it would fit your criteria. And you'ld be wrong. It would be based on igonrance. There is no positive test that yields objective evidence. There is only the pointing out of scientific ignorance + expressing the opinion of "it looks designed".

 

[TagliatelliMonster]

Granted, and not knowing the mechanism that caused the "Bang" does not invalidate the theory agree?

"caused" might not even be a sensible word.

Having said that, idd, we don't know about what triggered the big bang.
But once again: there is verififiable objective evidence in support of big bang theory.
It makes very precise, very testable, predictions which can be objectively and independently tested, without having to assume BB to be accurate.

Your "dembski" method or "design hypothesis" has no such predictions. It has no such evidence. It's not even a hypothesis. A hypothesis actually makes testable predictions.

If you think this dembski method DOES make testable predictions, which CAN be objectively and independently tested, then by all means: mention them.

 

[tas8831]

ReMine´s Argument is only valid if you are a selectionists who claims that most (or atleast a big portion) of the mutations that explain the differences between chimps and humans, if that is not you , then you the argument doesn’t apply…. As simple as that.

Wow, ReMine's argument is WAY simpler to defeat that he seems to think - it all comes down to whether or not someone is a strict selectionist. Since there are very few strict selectionists among professional biologists, I guess we can just ignore ReMine and his ego and his acolytes.
That was easy.

When are you going to let ReMine know? Because he still thinks his argument is totally beyond reproach.

.
In the same way radiometric dating would be useless if you don’t know the half life of the parent element… but so what?

If radiometric dating's main argument was that it has to know the date of something before it can be used to figure out how old it is, you might have a point.

Reasonable people understand that radiometric dating can only be used if you know the half live of the parent element, if you don’t have that data then you cant date the sample.

Half-life is a property of the element.
'Design' is a property foisted upon a substance by an external entity.
A designed thing does not 'have design', it IS designed, whereas a radioactive element HAS a half-life.

Bad analogy.

In the same way you have to know some of the attributes of “stuff” before applying the filter….

Yes, apparently you have to know whether it was designed before you apply the filter.
Like when Dembski acolytes have to know whether or not a DNA sequence is a gene before assessing whether or not is has CSI...

 

[tas8831]

Well the second is more specified than the first,

BUT YOU ONLY KNOW THAT BECAUSE I TOLD YOU!


If Dembski's 'filter' had merit, it should be able to have discerned that without me telling you about it.

It is like a smoke detector that the homeowner has to physically turn on when there is a fire so that the smoke detector will tell you there is a fire.

 

[Bear Wild]

As I said before. I don't know how the designer did it. I have no answer to that question.

What you have to do is justify your asertion and explain why is that a mayor flaw of the argument.

As I said before, not knowing how the pyramids where built does not invalidate the claim that the pyramids where designed.

Again pyramids are not alive, they are not self replicating organisms with genetic structure that changes with time and create new proteins from multiple ways of altering a portion of the genetic code. Termites can make termite mounds. Termites have the genetic capacity for change and to be able to pass on those changes, their mounds do not. Non living objects have no meaning in the discussion about how life diversified.

The justification is that you have no evidence for the intelligent designer or evidence to show the way the intelligent designer works. Even with all of the yet unsolved issues with evolution there is at least evidence for the mechanism for change. Even if something seems complex to us and ID people say the probability is low, the ability of genetic material to change exists and the probability is not zero thus it can happen and did. The reality is that genetic material changes with time and creates new proteins. There is absolutely no other evidence than genetic change to explain the diversity of life on Earth. You have provided only opinion that a magical god can do this and you did not answer all of my questions!
Compare this to the complete lack of any evidence showing a designer is at work. You have provided nothing other than opinion and inadequate attempts to find fault with evolutionary theory. Once an ID person has evidence showing the ID designer is making changes then you have an empty argument.
The lack of evidence for the Intelligent Designer and evidence of how that ID'er makes the changes leaves the ID with and empty with the major flaw of no evidence only imagination.

 

[TagliatelliMonster]

I note we are on page 136 of a "SIMPLE case for ID" and there still is no trace of even the slightest hint of an explanation of how ID is supposed to work or how design can be detected objectively.


Not that I expected any differently though....

 

[leroy]

Gene with 1500 bases.....

Creationists want to make it seem that it had to have been designed... how to do this? The tired old argument from awe is passe... got to find something new...

I know! Most of the population is math-averse... so lets use numbers! Hmmmm.... So this gene is 1500 bases long... there are 4 bases to pick from... So lets say the odds of this gene coming together all at once is 4^1500 - WOW! that is a HUGE number! We will then declare that therefore, no natural process could have put those 1500 bases in that order to make a gene all at once by chance!

Well it is true that you have to know somethings about the gene before applying the test, but you don't have to know a priori if it was designed. (why is this so hard to understand for you?)

Before infering design I would have to know if the gene is funcional, how many possible combinations are there, what percentage of possible combinations are there, if there is a bias in natural laws towards creating funcional genes etc.

'Wait - that is not how evolution works. Nobody said that a whole genes comes into existence all at once by chance. In fact, we do know that most genes are parts of gene families, i.e., their sequences are just slight variations on a theme, and are thus not bound by these silly claims about 'probabilistic resources' and such.'

Golly - what is a desperate creationist to do now?

'Oh, uh, well, you are misrepresenting the argument.. yeah, thats it... You're... um... putting words in my mouth! You... um.. are forgetting the big numbers! The specification! The CSI! The probabilistic resources! Doodly!'

Granted, if evolution (Darwinism) where true. There would be a bias in the natural laws towards creating functional Genes, thus the gene would fail to have the attribute of SC

 

[tas8831]

If all you need is a single deletion then by definition it can’t be IC nor CSI

Please demonstrate with relevant biology.

 

[tas8831]

Well it is true that you have to know somethings about the gene before applying the test, but you don't have to know a priori if it was designed. (why is this so hard to understand for you?)

Why is it so hard for you to provide a demonstration of the filter's worthiness on DNA sequences?

Why is it so hard for you to see that Dembski's whole plan was to fool rubes into thinking he had done something grand, and make some money? Nobody in mathematics of biology find his claims relevant or noteworthy. That is why he is no at some backwater bible college rather than at an R1 institution.

Before infering design I would have to know if the gene is funcional, how many possible combinations are there, what percentage of possible combinations are there, if there is a bias in natural laws towards creating funcional genes etc.

All mumbo jumbo - it is as if you and your heroes know almost nothing about how genomes operate and evolve.
Did you just ignore what I mentioned about gene families and the like because it spoils your routine, or could you not understand it?

So, have at it - this is part of an actual gene:

ATGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

Tell us all about the relevant "probabilistic resources", and " how many possible combinations are there, what percentage of possible combinations are there, if there is a bias in natural laws towards creating funcional genes etc."

Lets see this filter in action.

There would be a bias in the natural laws towards creating functional Genes, thus the gene would fail to have the attribute of SC

Please explain and provide supporting documentation for that claim.

After you provide an actual application of Dembski's folly to DNA sequences.