A simple case for intelligent design

[tas8831]

Right - you just have to be told if it possesses the hallmarks as put forth by the filter operator of having been designed, since the filter cannot do so on its own.

Yes that is true, but I don’t see why that is a problem.

wow... OK...

The claim is that if “stuff” has “X” and “Y” hallmarks you can infer design. If you don’t know what if it possess the hallmarks then you can’t apply the test. And the claim is falsifiable; you can show that something is “non-design” despite having the hallmarks.

Again I don’t see why is that a problem

Yes, and Kelly Blue Book asks people how much they would pay for automobile X, then publish how much automobile X is worth.

 

[tas8831]

Can you quote the part of the article where it says that the enzynme has 120 bases?

Why does that matter? You said that you cannot 'read the letters of DNA'.

 

[tas8831]

If you want to talk about DNA, how many possible combinations of bases can you have vs how many possible combinations would produce something that codes for a function.

But you have claimed that you cannot 'read the letters of DNA', so why on earth are you using DNA in your argument?

This:

AGTGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

Is not part of a gene. A deletion mutation at the 2nd site:

ATGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

renders it functional.

According to your filter, the first sequence has no meaning, and thus no CSI, and thus is not designed.

The second one, according to your filter, HAS meaning, HAS CSI, therefore IS designed.

Some filter.

 

[leroy]

How was that determined?

That just my suggestion, woudl you afirm otherwise?

 

[leroy]

I'ld even say that it is impossible for natural forces to make the sculptures in mt rushmore.
My question to you is: how do we know that?

Because Mt Rushemore has the atribute of specified complexity

But we'll get there... First answer my question above: how do we know that it's as good as impossible that natural forces won't be resulting in mt rushmore?

We don’t know with 100% certainty, but based on what we know about known natural laws, and based on observations, we can say with confidence that there is not a bias in natural laws for creating clear and unambiguous faces in rock…..sure you can always say that there might be some unknown natural law that can create faces in rock, but the burden proof would be on the guy who claims that such a law exists.

If you can't put a value on this "specificity" thingy, which should be able to be determined through an unambigous method based on the properties of the thing you are measuring, then it has no objective merrit. Then we are back to the subjective opinion of "i think it looks like X

".

The value of “complexity + specificity” is given by the ration of all the possible combinations and all the possible combinations that would produce the pattern that you are looking for or something equivalent.

The various functions of DNA are well explained through evolution theory

.
Granted if evolution where true and successful in explaining the origin of complex systems and functional genes, then there would be a Bias in natural laws in creating such systems, and such complex systems would fail the test …therefore you wouldn’t not be justified in inferring design.

But evolution has no bearing on the origin of life,

 

[leroy]

Specified after the fact, then.

I don’t know what you mean, but if I were to bet, I’ll say that you are putting words in my mouth

And how do you determine what the probabilistic resources are?

Show your work with a relevant example.

In the same way you would measure the probabilistic resources in any other circumstance. You just have to answer to this question “how many chances/tries” do you have? Someone who play the lottery 1 time has less probabilistic resources than someone who plays 100 times.[/QUOTE]

 

[leroy]

Because it shows how the creationists hawking 'not enough mutations' really have no argument.
You have presented ReMine's 'not enough mutations' argument, have you not?
Well, here is your chance to shine.

Cool burden shift.
I have no idea.
But I am NOT the one claiming that Haldane's model does not allow for enough, am I?

ReMine´s Argument is only valid if you are a selectionists who claims that most (or atleast a big portion) of the mutations that explain the differences between chimps and humans, if that is not you , then you the argument doesn’t apply…. As simple as that.

Ah, so the filter is useless

.
In the same way radiometric dating would be useless if you don’t know the half life of the parent element… but so what? Reasonable people understand that radiometric dating can only be used if you know the half live of the parent element, if you don’t have that data then you cant date the sample.

In the same way you have to know some of the attributes of “stuff” before applying the filter….

Sure I would admit that I would need to know a priori if a portion of DNA has a function before applying the filter. What I don’t see is why is that a problem and so far you haven’t provided any justification for why is that a problem

.

I note that you have yet to apply it to any aspect of a living thing as an example, rather, you have employed human works of design as analogies.

Well first let’s see if the test is successful in detecting design, and then we can explore whether if life passes the test or not.


BTW, you haven’t answer, would you say that the method is sucesfull in detecting human design? Yes or no?

 

[leroy]

Why does that matter? You said that you cannot 'read the letters of DNA'.

I can’t read DNA letters, but perhaps the author of the paper can (who knows?) I haven´t read any of the 2 articles yet)

 

[Subduction Zone]

In the same way radiometric dating would be useless if you don’t know the half life of the parent element… but so what? Reasonable people understand that radiometric dating can only be used if you know the half live of the parent element, if you don’t have that data then you cant date the sample.

In the same way you have to know some of the attributes of “stuff” before applying the filter….

Sure I would admit that I would need to know a priori if a portion of DNA has a function before applying the filter. What I don’t see is why is that a problem and so far you haven’t provided any justification for why is that a problem

This is not a very good analogy since we have the numbers for half lives. All that you have been able to provide is rather vague hand waving. It appears that you have not been able to properly define terms so that you ideas could be tested based on their own merit.

 

[leroy]

But you have claimed that you cannot 'read the letters of DNA', so why on earth are you using DNA in your argument?

This:

AGTGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

Is not part of a gene. A deletion mutation at the 2nd site:

ATGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

renders it functional.

According to your filter, the first sequence has no meaning, and thus no CSI, and thus is not designed.

The second one, according to your filter, HAS meaning, HAS CSI, therefore IS designed.

Some filter.

Well the second is more specified than the first, but it is not more complex (atleast not much more complex) therefore assuming that your starting point is “1” you can’t infer design. Consider that monkeys (chance) typing letters can eventually create words with meaning, specially is all you need is 1 additional letter (or deletion)

You should make an effort and try to understand the point, rather than trying to find holes and weaknesses in the semantics.

 

[TagliatelliMonster]

That just my suggestion

So here we are, trying to figure out how the Dembski method practically works, trying to work out how it can lead to objectively detecting design in things....

Then you claim that enzymes have "specified complexity".
I ask you how this was determined and THAT is your answer? That it's JUST your opinion??? JUST your "suggestion"? There's no test? No specific procedure to go through which then spews out a result that says it has SC or not in some kind of independent, objective fashion?

Instead just your opinion? And because it has specified complexity, it is likely designed, right?

So REALLY, this method here amounts to nothing more then "it looks designed to me therefor it is"?????

, woudl you afirm otherwise?

Sure, I can play the opinion game with Dembski's method too.

*ahum*

It has no specified complexity. Just my suggestion.



So there. I guess I can now conclude that it was not designed.

 

[TagliatelliMonster]

Because Mt Rushemore has the atribute of specified complexity

Sorry, no, that's circular.
Remember how you defined "specified complexity":

As I said before specified complexity can be defined as follows.

Complex : it has many parts or units

Specified: with meaning, function or any
other independent pattern

Independent : there is not a bias in natural laws towards producing that pattern

You cited "no bias in natural laws to produce that pattern" as one of the key aspects on how to determine SC. So when I ask how we know that natural forces won't produce such a thing, your answer can't be "because it has specified complexity".


So I ask again: how do we know that natural forces wouldn't produce such a thing?

We don’t know with 100% certainty, but based on what we know about known natural laws, and based on observations, we can say with confidence that there is not a bias in natural laws for creating clear and unambiguous faces in rock…..sure you can always say that there might be some unknown natural law that can create faces in rock, but the burden proof would be on the guy who claims that such a law exists.

You're still dancing around the actual question. You're simply repeating your claim that there is no such bias in nature to produce the Rushmore sculptures.

I'm asking you how do we know that? Note that I'm asking about rushmore specifically. So it's a question about rockformation, mountain formation, about erosion, ...

The value of “complexity + specificity” is given by the ration of all the possible combinations and all the possible combinations that would produce the pattern that you are looking for or something equivalent.

1. how could you possibly know of "all the possible combinations"?
2. how do you calculate these values?
3. from which value onward can we say that it is likely designed?
4. can you show, or explain, how this would work in practical application?

All these questions remain unanswered.
And from your other posts in this thread, like the one I answered in my post nr 2631 (A simple case for intelligent design), it seems to me as if the "dembski method" amounts to nothing more or less then "it looks designed to me so therefor it is"

Granted if evolution where true and successful in explaining the origin of complex systems and functional genes

It is. It's how we make sense of genetics. It's how we can determine who your biological siblings, parents, cousins, etc are. Because we understand how DNA works.

, then there would be a Bias in natural laws in creating such systems, and such complex systems would fail the test

So in other words, the REAL "criteria" for detecting design in the "dembski method" is as follows:
1. it looks to me as if this has specified complexity (expression of an opinion)
2. i don't know / understand how natural processes can produce it (expression of ignorance / incredulity)
3. therefor it is likely designed (conclusion based on an expression of opinion and an argument from ignorance / incredulity).


This seems to be the "method" so far.
I keep asking for ways to make this more objective and valid, but you keep coming short.

…therefore you wouldn’t not be justified in inferring design.

So pre-darwin, it was justified to infer design?
Premises of opinion and ignorance, leads to valid conclusion in your opinion?

But evolution has no bearing on the origin of life,

Indeed it doesn't. And it doesn't have to for the point at hand.

We don't know (yet) how life started or can start. So I guess you can apply your argument from ignorance of criteria nr 2 above to that portion for the time being and feel "justified" in asserting design.

 

[TagliatelliMonster]

Well the second is more specified than the first, but it is not more complex (atleast not much more complex) therefore assuming that your starting point is “1” you can’t infer design. Consider that monkeys (chance) typing letters can eventually create words with meaning, specially is all you need is 1 additional letter (or deletion)

You should make an effort and try to understand the point, rather than trying to find holes and weaknesses in the semantics.

You're trying to brush it aside, but the fact is that @tas8831 's example completely undermines your entire case.



ps: what his example also nicely illustrates, is one of the steps that shows how "irreducible complexity" is also a bunch of nonsense.

 

[leroy]

So here we are, trying to figure out how the Dembski method practically works, trying to work out how it can lead to objectively detecting design in things....

Then you claim that enzymes have "specified complexity".
I ask you how this was determined and THAT is your answer? That it's JUST your opinion??? JUST your "suggestion"? There's no test? No specific procedure to go through which then spews out a result that says it has SC or not in some kind of independent, objective fashion?

Instead just your opinion? And because it has specified complexity, it is likely designed, right?

So REALLY, this method here amounts to nothing more then "it looks designed to me therefor it is"?????





Sure, I can play the opinion game with Dembski's method too.

*ahum*

It has no specified complexity. Just my suggestion.



So there. I guess I can now conclude that it was not designed.

The reason why I said that it is just a suggestion, is because I haven’t read the 2 articles provided by Pollymath, I am just speculating that nowhere in the article will the authors deny that those proteins have the attribute of SC.

 

[TagliatelliMonster]

The reason why I said that it is just a suggestion, is because I haven’t read the 2 articles provided by Pollymath, I am just speculating that nowhere in the article will the authors deny that those proteins have the attribute of SC.

I'm certain that they won't, because SC is completely irrelevant.
I'm sure they also won't be denying in the articles that enzymes are regulated by rainbow pooping unicorns.


Having said that, you're backpeddaling again.
You clearly made the claim that those enzymes have "specified complexity". Earlier you even also made the claim that it is "impossible" for such enzymes to form by natural processes:

The claim is not that self replicating enzymes cant exist, the claim is that such enzymes cant be created by natural mechanism (without preexisting life) because these enzymes would have the attribute of specified complexity,

I asked you how you determined that, and you basically acknowledged twice now that you're just sucking it out of your thumb. And then stating it as if it were fact.

Your use of the word "because" in the above quote is also interesting imo.
As I quoted in another post, earlier you defined criteria by which "specified complexity" is determined. One of those criteria was "natural law not having a bias to produce said structures".

Setting it as a seperate criteria, it implies that stuff can have all the ingredients of "specified complexity", while still being produced by natural processes.

However, your use of the word "because" here, is saying the opposite. That is by definition impossible for structures with "specified complexity" to be produced by natural processes.


It seems that the deeper we dig into this "method", the more exposed the internal inconsistency becomes....​

 

[leroy]

So I ask again: how do we know that natural forces wouldn't produce such a thing?

the answer is direct observation

we know with a high degree of certanity because wind and errotion have been observed and studied, and based on what we have seen, there is no bias in producing faces.

1. how could you possibly know of "all the possible combinations"?
2. how do you calculate these values?
3. from which value onward can we say that it is likely designed?
4. can you show, or explain, how this would work in practical application?

1 and 2 ) just do the math, each "stuff" would have a different method, for example if I type 10 letters and we assume that my keyboeard has 100 characters, then there woudl be 100000000000000000000 possible combinations

3 Its a probabilistic arguemnt, there is not a specific point where you would say "Design" it is just that design becomes more and more likelly as the level of SC increses

4
Sure pretend that there is a 50% chance that a thief would try to open the luck of bike by guessing the combination, and a 50% chance that the owner of the bike that knows the combination, would be the one who will try to open the luck of the bike (pretend that the luck has 3 digits or 1,000 possible combinations)

If the individual opened luck at the first try, you can be nearly certain that this individual is the owner of the bike, if the luck is opened in the second try you will be less certain, if it is opened in the 3 try you would be even less certain,… if it was opened after 500 ties, then the “thief hypothesis” (chance) would be better than the “owner hypothesis” (Design) …obviously I can’t spot exactly at what point one should prefer chance over design, but so what? That doesn’t mean that I can’t infer design at least under some given circumstances.agree? answer yes or no

So in other words, the REAL "criteria" for detecting design in the "dembski method" is as follows:
1. it looks to me as if this has specified complexity (expression of an opinion)
2. i don't know / understand how natural processes can produce it (expression of ignorance / incredulity)
3. therefor it is likely designed (conclusion based on an expression of opinion and an argument from ignorance / incredulity).

1 it is not an opoinion, for example it is an objective fact that a text with 10 letters has less unitis than a text with 100 letters, (therefore the text with 100 letters is objectivly more complex by this defintion)

and it is a fact that most combinatios of letters woudl produce meaningless text (specified)

this is not an opinion, there are objective and verifiable facts

2 Its a testable and falsifiable conclustion based on the data that we have to date, based on the data that we have to date wind and errotion has no bias in producing faces,

3 no,

So pre-darwin, it was justified to infer design?

yes

Premises of opinion and ignorance, leads to valid conclusion in your opinion?

no

You are just fooling yourself, you what to pretend that the concept of SC is meaningless or ambiguous because you know that you don’t have any real objection to the argument.

We don't know (yet) how life started or can start. So I guess you can apply your argument from ignorance of criteria nr 2 above to that portion for the time being and feel "justified" in asserting design.

Granted but there are a few things that we do know, for example we know that all known self-replicating agents (cells, bacteria, archea, etc.) require multiple parts systems and reactions (complexity) in order to self-replicate and we know that these parts systems and reactions have to occur and be organized in a very specific way, otherwise the cell would fail to reproduce (specified)

We also know that prebiotic chemistry is not interested in creating life, nor self-replicating molecules, chemicals don’t tend to organize in a convenient order, just to name an example the ration of left handed and right handed aminoacids tends to be 50 / 50 in any chain of aminoacids, aminoacids don’t seem to be interested in forming long chains of left handed aminoacids. … there is no bias in the laws of nature for preferring left handed amoacids, the bias seems to be a ratio of 50% 50%

So based on what we do know, it seems that even the first living thing would have the attribute of SC

*in this context with living thing I mean any organic thing that can reproduce.

I am not “just asserting design” I provided good, testable and falsifiable reasons,

 

[leroy]

I'm certain that they won't, because SC is completely irrelevant.
I'm sure they also won't be denying in the articles that enzymes are regulated by rainbow pooping unicorns.


Having said that, you're backpeddaling again.
You clearly made the claim that those enzymes have "specified complexity". Earlier you even also made the claim that it is "impossible" for such enzymes to form by natural processes:

I asked you how you determined that, and you basically acknowledged twice now that you're just sucking it out of your thumb. And then stating it as if it were fact.

Your use of the word "because" in the above quote is also interesting imo.
As I quoted in another post, earlier you defined criteria by which "specified complexity" is determined. One of those criteria was "natural law not having a bias to produce said structures".

Setting it as a seperate criteria, it implies that stuff can have all the ingredients of "specified complexity", while still being produced by natural processes.

However, your use of the word "because" here, is saying the opposite. That is by definition impossible for structures with "specified complexity" to be produced by natural processes.


It seems that the deeper we dig into this "method", the more exposed the internal inconsistency becomes....​

Well the burden proof is on the one who affirms that such enzymes can be created naturally isn’t it?
answer yes or no?



I haven tread the articles, but my prediction is that nowhere in the article does the author concludes that these enzymes can be created naturally without a designer and without preexisting life.

And I would also predict that the process of self-replication of these enzymes involve multiple independent, specific and well organicd parts, systems and reactions, (specified complexity)

So these are my predictions, I honestly have no idea if these predictions have been tested nor confirmed, but this proves that I am willing to make testable, falsifiable and realistic predictions…… being a naturalist, what prediction can you make ?

 

[leroy]

You're trying to brush it aside, but the fact is that @tas8831 's example completely undermines your entire case.



ps: what his example also nicely illustrates, is one of the steps that shows how "irreducible complexity" is also a bunch of nonsense.

If all you need is a single deletion then by definition it can’t be IC nor CSI

What surprises me is that Both Behe and Demski (and I) have explicitly manifest that such examples can be a product of “non design”so I have no idea why would someone argue that such exampls falsify Behe or Demski. All this shows is that you don’t understand the argument which means that you are in no position to claim that they are wrong.


Try to make an effort and try to actually understand the argument, rather than trying to find holes and weaknesses in the semantics, .. If you what to refute the argument, try to refute the actual point, rather than the semantics.

 

[Astrophile]

Because Mt Rushmore has the attribute of specified complexity





We don’t know with 100% certainty, but based on what we know about known natural laws, and based on observations, we can say with confidence that there is not a bias in natural laws for creating clear and unambiguous faces in rock…..sure you can always say that there might be some unknown natural law that can create faces in rock, but the burden proof would be on the guy who claims that such a law exists.

Does this have 'the attribute of specified complexity'?



.

 

[Astrophile]

The definition of meaning is not relevant, any definition from any dictionary would work.

As I said before specified complexity can be defined as follows.

Complex : it has many parts or units

Specified: with meaning, function or any
other independent pattern.

Independent : there is not a bias in natural laws towards producing that pattern

To me this definition is clear, unambiguous and can be measured.

Something that is designed does not need to be complex. A pencil or an arrow or a stone hand-axe does not have many parts or units, but it is still designed. Conversely a piece of rock may be complex, in the sense of containing a large number of different minerals, or even of containing different types of rock in a single hand specimen, but that does not mean that it is designed.