Remarkably complete’ 3.8-million-year-old cranium of human ancestor discovered in Ethiopia

[dad]

It's not that the creationists are too stupid to understand those things, it's that understanding is too risky.
.

Your problem is that many do understand those things and realize they are belief based nonsense.

 

[Subduction Zone]

Your problem is that many do understand those things and realize they are belief based nonsense.

How would you know? Seriously dude. And when you answer please keep the Ninth Commandment in mind.

 

[nPeace]

You wrote (emphasis mine):
"I said mutations are the result of copying errors. So it seems to me, the marginal benefits of a mutation, must be so due to other factors."

Yes. I suppose you want to know what that means.
I remembered reading somewhere, that beneficial mutations are marginal. When I find it I will share the link with you.
I think that since mutations result from copying errors, aside from other things like poisons, contamination, etc., then any benefits that mutation can produce, would be due to other factors, like say, adaptation of genes, to the change... sort of like how the immune system works.
As I said, I am no scientists, but I am reasoning, and want to hear your scientific input.
It would be good if you can link some brief information to support what you are saying.

That's not an answer to my question. What mechanism do you propose produced the ability for these creatures to do this?

I answered your question. Perhaps it's not the answer you are looking for, but I don't know what you are looking for.
I believe the peppered moth carried the camouflage gene, as far back as they had it, as little caterpillars... or rather, before hatching. If they acquired it through adaptation, then that would be by natural selection, as I understand it.

That mutations "revert" or have to revert in order to return to a similar form. That's not how mutations work.

I didn't say that. I said, Mutations are one directional. They don't revert.
So your saying, "that not true" seem to have been said, just so... for no reason.
However, that trivial.

Sure. Let's say the arrangement of the genome for beak shape is:

AAGBCGA

However, due to a copying error, part of the genome is altered:

AAGCGA

So the 'B' has been removed, but this didn't "delete information" as much as it changed the sequence. This change can have a variety of effects, but let's for the sake of simplicity say that B played a vital role in making sure the beak was a particular shape. Now, the beak is a slightly different shape - let's say, long and sharp. However, a further change in a genome:

AAGGA

Removes 'C', and let's say that C played a vital role in making the beak longer and sharper. Now, even if the genome no longer has the 'B' that made sure the beak was flatter and more blunt, the lack of 'C' means it is now free (or more free) to be more blunt and flat once again.

No mutation had to necessarily "revert" in order for this to occur. It's all done progressively. Of course, this is a dramatic, dramatic oversimplification, but if you would like more specifics I'd advise you to ask someone more versed in genetics than me.

Thanks.
Your genome was not accurate. It should have base pairs... more like this - ATCGGCAT.
Now if we use your analogy, I think we should forget about "Darwin's finches", since you seem to be getting into the area of magic. The mutation happens to hit the same gene back and forth... Right.
Did the beaks change, and change back, though?
I understand there were interbreeding species, so if natural selection played a role in adaptation, that makes sense to me.
What do you say?

Where do you think I've written anything that contradicts this? What do you think this extract is saying?

What do I think it's saying? That's an odd question. Read the red. That's what it's saying.

That's not what I've written. Please try to pay more attention. I said a mutation only proliferates IF it produces an advantage. That doesn't mean the mutation wasn't random - it means that, from the random mutations that exist, the ones that DO provide a benefit will multiply.

What about the ones that DO NOT provide a benefit... what happens to them?

No, it will be natural selection. I've already explained that.

Then propose another mechanism that produces variation through reproduction.

Another mechanism??? Besides mutations?
Many Black Jamaican couples are having babies that look mixed with Asian.
There is a phenomenon that is sweeping across Jamaica. More and more we are seeing couples having babies where both the mother and father are Black but the baby comes out looking not only light skin but also features that look like they are mixed with Asian.
Babies color and other physical features are due to the genes inherited not only from their parents but also from parents of parents going many generations back. So a Black man or woman could be carrying a Asian gene that they themselves do not physically show it but it can be passed on to their baby.

Variation in generations of gene mixing.
Mutations will come - whether they effect a small change, no change, or a large change, but we do observe that the vast majority of mutations are either neutral or harmful.

The Eve hypothesis, first published in 1987, suggests that all human DNA can be traced back to a single female. This "Eve" would have lived in Africa about 200,000 years ago.
The latest research challenges an alternative theory which holds that several different groups of humans evolved separately at the same time in several places around the world.
A Single Migration From Africa Populated the World, Studies Find

(Genesis 3:20) After this Adam named his wife Eve, because she was to become the mother of everyone living.
(Genesis 4:1) Now Adam had sexual relations with his wife Eve, and she became pregnant.
(1 Timothy 2:13) For Adam was formed first, then Eve.
(Acts 17:26) And he [God] made out of one man every nation of men to dwell on the entire surface of the earth, ...

That could be responsible, but then where would that variety of species have come from in the first place?

Certainly not through mutations. Genesis Chapter 1 tells us. Also, see above

... Yes.

Because it demonstrably and literally is. Variations in humans are due to mutations and differences in DNA.

We disagree obviously. Please show me the papers that demonstrate that different sizes and shaped noses are due to mutations.

What is incoherent about it? It's very simple:

A mutation which arises that produces an advantage to survival will lead to organisms carrying that mutation having a survival advantage. It really is as simple as that.

Okay.

You're unaware that populations can grow too large for one ecosystem to sustain them, or of populations migrating?

No. I am not unaware. I just don't understand what you were saying. As I said, it sounded confusing. Perhaps you didn't structure it properly.

I'm saying the first population significantly increased in number, leading to a spreading out of the species over a wider area. That's what happens when a relatively small number of animals in one location grows - they have to spread out to find new food sources and/or living spaces.

Yes, and the second population moved from another area to mix with those in the original location. Okay. That's all i was asking.

You seem confused. Do you understand that he doesn't literally mean that the mutation AROSE because of then need for it, but that the mutation PROLIFERATED because it provided an advantage?

How do you know that's what he meant? Did he say that?

Let's say we have a population of shrews that live on the floor of a forest, and these shrews have a brownish fur that allows them some degree of camouflage with the forest floor that protects them from predators. This developed due to natural selection, as the lighter-haired shrews tend to be easier catches for the predators, resulting in the darker-furred shrews being more likely to survive. Over time, the lighter-haired mutation was significantly overtaken by the darker-haired mutation, resulting in future generations of the shrew being almost entirely darker haired.

Why do you call it a lighter haired mutation, and a darker haired mutation? Did you not say natural selection drove the adaptation?

Now, if I was to say "The darker fur developed because of the shrew's need for camouflage", I am not literally saying "the mutation appeared because the shrew's genome decided it would be really useful to have camouflage". I am saying "this particular mutation proliferated within the population and became the standard because it was environmentally selected for".

Do you understand?

I understand what you are telling me. So how does selection work in helping the shrews to adapt to darker fur?

 

[nPeace]

Once again your lack of knowledge and understanding is on display. A mutated version of a gene is a version of a gene that is broken. In other words, it's mostly present but is corrupted so that it no longer functions. A reasonable analogy would be finding a sentence in English that says "zhis is to pake egg ykke." - like typos in the base-pairs.

When it happened is all but irrelevant to the point - the fact remains that it is there.



You keep on reinforcing the point yourself. It's really rather comical, and sad, how little you seem to know about something you are making sweeping accusations about.



Perhaps if you posted it again, I'd know what the **** you're talking about (even if you didn't).

Please provide a paper, or papers of what you are talking about.

 

[Bear Wild]

Why do you call it a lighter haired mutation, and a darker haired mutation? Did you not say natural selection drove the adaptation?


I understand what you are telling me. So how does selection work in helping the shrews to adapt to darker fur?

They are not adapting to darker fur. Genetic mutations, rearrangements, splicing, epigenetic factors and many more aspects of genetic changes to the DNS create the variations. Many are not expressed and can be carried through generations unexpressed. Natural selection does not help, it is a selection pressure. The genetics give the variations that allow some to have an advantage when the selection process favors those with any phenotypic expression.

 

[nPeace]

Then what is it the knowledge of?

Whenever I say that Jews believe something, I'm referring to a common belief among religious Jews. For example, Jews accept the Talmud, or Jews keep the Shabbat. It don't mean absolutely all religious Jews -- there are exceptions. And it doesn't include non-religious Jews. It will also mean there are variations in what it precisely means. For example, an Orthodox Jew will keep the Shabbat in a very strict way and a Reform Jew will keep the Shabbat in a very lenient way.

No, seriously, I'm not wanting to give you busywork. You have esoteric understandings, and I'm finding it difficult to get a hold of where you are coming from. I have really no idea what YOU mean when you say you are a follower of Jesus, since you say you are not a Christian and don't accept the standard understandings. You see I know what the standard interpretations are, but I don't know what YOUR interpretations are. So I have asked you for them. You don't have to write me a book. Just give me a list of maybe the 10 most important things.



Jesus was talking to the rich man, who was a Jew. He told him that in order to gain eternal life he was to observe the commandments. For that Jew, that meant 613 of them, including circumcision. That Jew was bound by a covenant with God. These are the people to whom Jesus preached.

It was Paul and the apostles who determined that Gentiles did not need to become Jews. (Jewish law also says that Gentiles need not become Jews, but only need to be ethical monotheists.) But Jesus nowhere deals with the question of Gentiles. He only gives one answer, and it is the answer above -- obey the 613 commandments that God gave the Jews.

What Paul and the apostles said??? That's not the question. The question was what did Jesus say.

So that I don't forget. I'll get back to you later.

 

[IndigoChild5559]

A muted version of a gene. A muted version of a gene?
Tell me please, when was this gene muted? What bird told you? The evolutionary presumption.


There goes that song again. Obviously you guys don't appear bored by these, but they are, to me... boring


Perhaps if you were not so terrified and eager to get away, you would know. Maybe you don't want to know.


Ha Ha.

Are you serious? We know that genes mutate. We have empirical evidence of it.

 

[ratiocinator]

Please provide a paper, or papers of what you are talking about.

Here is an article on genetic evidence (mostly concentrating on humans) that includes the egg yoke gene:
Genesis and the Genome: Genomics Evidence for Human-Ape Common Ancestry and Ancestral Hominid Population Sizes (pdf)

It has many references to papers, but here is the one about egg yoke (vitellogenin gene):
Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation

 

[ImmortalFlame]

Yes. I suppose you want to know what that means.
I remembered reading somewhere, that beneficial mutations are marginal. When I find it I will share the link with you.

But we've already established that mutations can produce significant changes, so it's possible for a beneficial mutation to also be significant.

I think that since mutations result from copying errors, aside from other things like poisons, contamination, etc., then any benefits that mutation can produce, would be due to other factors, like say, adaptation of genes, to the change... sort of like how the immune system works.
As I said, I am no scientists, but I am reasoning, and want to hear your scientific input.
It would be good if you can link some brief information to support what you are saying.

This is all elementary genetics, really, so your best bet is to read any article about mutations rates and how mutations add up over subsequent generations:
Mutation rate - Wikipedia

I answered your question. Perhaps it's not the answer you are looking for, but I don't know what you are looking for.

Not really. I asked you how variation in genetics came about, and you said that some organisms have the ability to change themselves - but that's nothing to do with the inheritable genetic changes that allow that process to occur. The question is how they came to be able to do that.

I believe the peppered moth carried the camouflage gene, as far back as they had it, as little caterpillars... or rather, before hatching. If they acquired it through adaptation, then that would be by natural selection, as I understand it.

You're actually not technically wrong here, because the gene DID exist - as the genes for all potential formations exist in the genetic code going back all the way to the earliest eukaryote. The potential always existed, but it took mutations to produce it, and then selection to proliferate it.

Thanks.
Your genome was not accurate. It should have base pairs... more like this - ATCGGCAT.
Now if we use your analogy, I think we should forget about "Darwin's finches", since you seem to be getting into the area of magic. The mutation happens to hit the same gene back and forth... Right.

No, that's the exact opposite of the point of my analogy. The mutations didn't "go back and forth", the mutations were one way, but that doesn't mean the future mutation cannot alter a previous one.

Did the beaks change, and change back, though?

They never necessarily change "back" - but mutations allow for new forms to arise, and those new forms can be the same (potentially, identical) to old ones.

I understand there were interbreeding species, so if natural selection played a role in adaptation, that makes sense to me.
What do you say?

To what?

What do I think it's saying? That's an odd question. Read the red. That's what it's saying.

But what do you think it's saying that contradicts what I have written? I've never claimed mutations can be repaired.

What about the ones that DO NOT provide a benefit... what happens to them?

They aren't selected for, so they generally don't proliferate.

Another mechanism??? Besides mutations?
Many Black Jamaican couples are having babies that look mixed with Asian.
There is a phenomenon that is sweeping across Jamaica. More and more we are seeing couples having babies where both the mother and father are Black but the baby comes out looking not only light skin but also features that look like they are mixed with Asian.
Babies color and other physical features are due to the genes inherited not only from their parents but also from parents of parents going many generations back. So a Black man or woman could be carrying a Asian gene that they themselves do not physically show it but it can be passed on to their baby.

Variation in generations of gene mixing.
Mutations will come - whether they effect a small change, no change, or a large change, but we do observe that the vast majority of mutations are either neutral or harmful.

The Eve hypothesis, first published in 1987, suggests that all human DNA can be traced back to a single female. This "Eve" would have lived in Africa about 200,000 years ago.
The latest research challenges an alternative theory which holds that several different groups of humans evolved separately at the same time in several places around the world.
A Single Migration From Africa Populated the World, Studies Find

You realize that this is all genetics, right? It's just another form of mutation.

Certainly not through mutations. Genesis Chapter 1 tells us. Also, see above

You've not presented any mechanism other than mutation. And I'm not remotely interested in what the Bible says. We're discussing science, not religion.

We disagree obviously. Please show me the papers that demonstrate that different sizes and shaped noses are due to mutations.

Investigating the case of human nose shape and climate adaptation
https://www.quora.com/What-determines-the-shape-and-size-of-ones-nose
Genes for nose shape found

Honestly, this is really, really basic stuff. Where on earth do you think physical characteristics come from??

No. I am not unaware. I just don't understand what you were saying. As I said, it sounded confusing. Perhaps you didn't structure it properly.

I thought I structured it quite well. I specifically wrote that the second population arose from the first population growing in size.

How do you know that's what he meant? Did he say that?

Because anybody who understands how evolution works would know that they weren't being literal. Where is your evidence that they literally meant that mutations "decided" to occur?

Why do you call it a lighter haired mutation, and a darker haired mutation? Did you not say natural selection drove the adaptation?

Again, you seem confused. Adaptation requires BOTH mutation and selective pressure. Natural selection drives the adaptation by selecting from the available mutations.

It goes:

(Mutations arise in a population) -> (Natural selection selects from those mutations) -> (Gene frequency of population alters)

I understand what you are telling me. So how does selection work in helping the shrews to adapt to darker fur?

The shrews don't "adapt to the fur". The darker fur is mutation that produces a benefit to the shrews, providing them greater camouflage, and thus naturally selection results in that gene proliferating since - being better camouflaged - that darker furred shrews are slightly more likely to survive and produce offspring that will then carry that same dark-furred mutation.

 

[nPeace]

Are you serious? We know that genes mutate. We have empirical evidence of it.

That's muted, not mutated.

 

[nPeace]

Here is an article on genetic evidence (mostly concentrating on humans) that includes the egg yoke gene:
Genesis and the Genome: Genomics Evidence for Human-Ape Common Ancestry and Ancestral Hominid Population Sizes (pdf)

It has many references to papers, but here is the one about egg yoke (vitellogenin gene):
Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation

Thanks. I'll have a look.

 

[nPeace]

But we've already established that mutations can produce significant changes, so it's possible for a beneficial mutation to also be significant.


This is all elementary genetics, really, so your best bet is to read any article about mutations rates and how mutations add up over subsequent generations:
Mutation rate - Wikipedia


Not really. I asked you how variation in genetics came about, and you said that some organisms have the ability to change themselves - but that's nothing to do with the inheritable genetic changes that allow that process to occur. The question is how they came to be able to do that.


You're actually not technically wrong here, because the gene DID exist - as the genes for all potential formations exist in the genetic code going back all the way to the earliest eukaryote. The potential always existed, but it took mutations to produce it, and then selection to proliferate it.


No, that's the exact opposite of the point of my analogy. The mutations didn't "go back and forth", the mutations were one way, but that doesn't mean the future mutation cannot alter a previous one.


They never necessarily change "back" - but mutations allow for new forms to arise, and those new forms can be the same (potentially, identical) to old ones.


To what?


But what do you think it's saying that contradicts what I have written? I've never claimed mutations can be repaired.


They aren't selected for, so they generally don't proliferate.


You realize that this is all genetics, right? It's just another form of mutation.


You've not presented any mechanism other than mutation. And I'm not remotely interested in what the Bible says. We're discussing science, not religion.


Investigating the case of human nose shape and climate adaptation
https://www.quora.com/What-determines-the-shape-and-size-of-ones-nose
Genes for nose shape found

Honestly, this is really, really basic stuff. Where on earth do you think physical characteristics come from??


I thought I structured it quite well. I specifically wrote that the second population arose from the first population growing in size.


Because anybody who understands how evolution works would know that they weren't being literal. Where is your evidence that they literally meant that mutations "decided" to occur?


Again, you seem confused. Adaptation requires BOTH mutation and selective pressure. Natural selection drives the adaptation by selecting from the available mutations.

It goes:

(Mutations arise in a population) -> (Natural selection selects from those mutations) -> (Gene frequency of population alters)


The shrews don't "adapt to the fur". The darker fur is mutation that produces a benefit to the shrews, providing them greater camouflage, and thus naturally selection results in that gene proliferating since - being better camouflaged - that darker furred shrews are slightly more likely to survive and produce offspring that will then carry that same dark-furred mutation.

Yeah though. Those nose papers were really hilarious.
I hope you don't mind, but I want to zero in on one thing, since it seem to be the major conflict we are having. You say mutations, I say no. Natural selection. Mutations are vastly harmful or neutral, and for every beneficial mutation, there can be many many more harmful.

So explain how mutations were responsible for these, and how the animals sense of awareness and the mutation became harmonized.
Phasmatodea - Wikipedia
Antipredator adaptations
Some species have the ability to change color as their surroundings shift ...

When disturbed on a branch or foliage, some species, while dropping to the undergrowth to escape, will open their wings momentarily during free fall to display bright colors that disappear when the insect lands. Others will maintain their display for up to 20 minutes, hoping to frighten the predator and convey the appearance of a larger size....

The eggs of some species such as Diapheromera femorata have fleshy projections resembling elaiosomes (fleshy structures sometimes attached to seeds) that attract ants. When the egg has been carried to the colony, the adult ant feeds the elaiosome to a larva while the phasmid egg is left to develop in the recesses of the nest in a protected environment...

Some species are equipped with a pair of glands at the anterior (front) edge of the prothorax that enables the insect to release defensive secretions, including chemical compounds of varying effect: some produce distinct odors, and others can cause a stinging, burning sensation in the eyes and mouth of a predator....
etc.

Hope I haven't lost you.

Also, this seems to agree with me, and does not require mutations, apparently.
Coloration evidence for natural selection

I think, as you agreed, the gene is there, but I think the animal has the built in "instinct" to utilize their capabilities. Just as a lizard can shed its skin to feed, or lose its tail, and regrow it, and the stick insect can drop its wings and regrow them.

 

[nPeace]

Here is an article on genetic evidence (mostly concentrating on humans) that includes the egg yoke gene:
Genesis and the Genome: Genomics Evidence for Human-Ape Common Ancestry and Ancestral Hominid Population Sizes (pdf)

It has many references to papers, but here is the one about egg yoke (vitellogenin gene):
Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation

I noticed the last link is to an article I was already looking at, but I wasn't seeing what you were saying, so I thought you had another paper you got you information from.
Since I had already gone through most of the paper, including the conclusion, could you extract the particular paragraph(s) you have in mind, and post that... in keeping with forum rule #7
When quoting material external to RF, even if it is your own, always provide a citation and limit your quotation to a paragraph or two rather than quoting the entire content...

 

[IndigoChild5559]

That's muted, not mutated.

No, I said and meant mutated.

 

[ratiocinator]

I noticed the last link is to an article I was already looking at, but I wasn't seeing what you were saying, so I thought you had another paper you got you information from.
Since I had already gone through most of the paper, including the conclusion, could you extract the particular paragraph(s) you have in mind, and post that... in keeping with forum rule #7
When quoting material external to RF, even if it is your own, always provide a citation and limit your quotation to a paragraph or two rather than quoting the entire content...

From Genesis and the Genome (pdf):

One protein used as a yolk component in egg-laying vertebrates is the product of the vitellogenin gene. Since placental mammals are proposed to be descended from egg-laying ancestors, researchers recently investigated whether humans retained the remnants of the vitellogenin gene sequence in pseudo-gene form. To assist in their search, this group determined the location of the functional vitellogenin gene in the chicken genome, noted the identity of the genes flanking the vitellogenin sequence, and located these genes in the human genome. They found that these genes were present side-by-side and functional in the human genome; then they performed an examination of human sequence between them. As expected, the heavily mutated, pseudogenized sequence of the vitellogenin gene was present in the human genome at this precise location.
​

From Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation:

Eutherians would be expected to have lost the VIT genes during their passage to viviparity. To analyze whether they have indeed completely lost the capacity for VTG production, we screened two representative eutherian genomes of high quality (human and dog) for the presence of VIT genes. Interestingly, by using highly sensitive similarity search algorithms [21,22] (see Materials and Methods), we identified a few VIT pseudogenic coding sequence remnants (mainly from VIT1 and VIT3) with premature stop codons and frame-shifting insertion/deletions (indels) in regions syntenic to those containing these VIT genes in chicken (Figure 2 and Figure S1).​

Edited to add:
Here is part of the actual match, modified from figure S2 - I've removed the other species and redone the matching indicators to reflect that. Bear in mind they didn't trawl through the genome looking for a match, it appears in the place expected assuming humans and chickens have a common ancestor.

Gallus gallus          AACCTGATTTTGGTGAAAATAAGGTTTATACATACAATTATGAAAGCATACTTTTCAGTG
Homo sapiens           AACCTAACTTCCA-GAAAGGGTGACTTATGATTCTAAATATGAAAGTACA-TTTCTAGTG
                       ***** * **    ****    *  ****   *  ** ******** * * ***  ****

Gallus gallus          GTATTCCAGAGAAAGGACTTGCAAGAACTGGAATAAGGATAAGAAGTGAAGTGGAAATTA
Homo sapiens           TATTTCCACA-ACAGTACTTAGAAGACCTGGGATGTAAACAAAAAGTAAAGTAGAAGTCA
                          ***** * * ** ****  **** **** **    * ** **** **** *** * *

Gallus gallus          GTGGTATTGGACCAAAACTTTGTCTTATTAGG
Homo sapiens           CTGGCACAGATCTGAAACCAAGTTTTATTAAG
                        *** *  *  *  ****   ** ****** *

 

[ImmortalFlame]

Yeah though. Those nose papers were really hilarious.
I hope you don't mind, but I want to zero in on one thing, since it seem to be the major conflict we are having. You say mutations, I say no. Natural selection. Mutations are vastly harmful or neutral, and for every beneficial mutation, there can be many many more harmful.

This is not true. The vast majority of mutations are neutral. Only a small minority are beneficial or harmful.

So explain how mutations were responsible for these, and how the animals sense of awareness and the mutation became harmonized.

What do you even mean by "awareness and mutation being harmonized?"

Phasmatodea - Wikipedia
Antipredator adaptations
Some species have the ability to change color as their surroundings shift ...

When disturbed on a branch or foliage, some species, while dropping to the undergrowth to escape, will open their wings momentarily during free fall to display bright colors that disappear when the insect lands. Others will maintain their display for up to 20 minutes, hoping to frighten the predator and convey the appearance of a larger size....

The eggs of some species such as Diapheromera femorata have fleshy projections resembling elaiosomes (fleshy structures sometimes attached to seeds) that attract ants. When the egg has been carried to the colony, the adult ant feeds the elaiosome to a larva while the phasmid egg is left to develop in the recesses of the nest in a protected environment...

Some species are equipped with a pair of glands at the anterior (front) edge of the prothorax that enables the insect to release defensive secretions, including chemical compounds of varying effect: some produce distinct odors, and others can cause a stinging, burning sensation in the eyes and mouth of a predator....
etc.

What exactly do you want me to explain? What do you think prevents these things arising through mutation?

Also, this seems to agree with me, and does not require mutations, apparently.
Coloration evidence for natural selection

I think, as you agreed, the gene is there, but I think the animal has the built in "instinct" to utilize their capabilities. Just as a lizard can shed its skin to feed, or lose its tail, and regrow it, and the stick insect can drop its wings and regrow them.

I really don't understand what you think this is saying. What makes you think this process doesn't involve genetic mutation?

 

[nPeace]

From Genesis and the Genome (pdf):

One protein used as a yolk component in egg-laying vertebrates is the product of the vitellogenin gene. Since placental mammals are proposed to be descended from egg-laying ancestors, researchers recently investigated whether humans retained the remnants of the vitellogenin gene sequence in pseudo-gene form. To assist in their search, this group determined the location of the functional vitellogenin gene in the chicken genome, noted the identity of the genes flanking the vitellogenin sequence, and located these genes in the human genome. They found that these genes were present side-by-side and functional in the human genome; then they performed an examination of human sequence between them. As expected, the heavily mutated, pseudogenized sequence of the vitellogenin gene was present in the human genome at this precise location.
​

From Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation:

Eutherians would be expected to have lost the VIT genes during their passage to viviparity. To analyze whether they have indeed completely lost the capacity for VTG production, we screened two representative eutherian genomes of high quality (human and dog) for the presence of VIT genes. Interestingly, by using highly sensitive similarity search algorithms [21,22] (see Materials and Methods), we identified a few VIT pseudogenic coding sequence remnants (mainly from VIT1 and VIT3) with premature stop codons and frame-shifting insertion/deletions (indels) in regions syntenic to those containing these VIT genes in chicken (Figure 2 and Figure S1).​

Edited to add:
Here is part of the actual match, modified from figure S2 - I've removed the other species and redone the matching indicators to reflect that. Bear in mind they didn't trawl through the genome looking for a match, it appears in the place expected assuming humans and chickens have a common ancestor.

Gallus gallus          AACCTGATTTTGGTGAAAATAAGGTTTATACATACAATTATGAAAGCATACTTTTCAGTG
Homo sapiens           AACCTAACTTCCA-GAAAGGGTGACTTATGATTCTAAATATGAAAGTACA-TTTCTAGTG
                       ***** * **    ****    *  ****   *  ** ******** * * ***  ****

Gallus gallus          GTATTCCAGAGAAAGGACTTGCAAGAACTGGAATAAGGATAAGAAGTGAAGTGGAAATTA
Homo sapiens           TATTTCCACA-ACAGTACTTAGAAGACCTGGGATGTAAACAAAAAGTAAAGTAGAAGTCA
                          ***** * * ** ****  **** **** **    * ** **** **** *** * *

Gallus gallus          GTGGTATTGGACCAAAACTTTGTCTTATTAGG
Homo sapiens           CTGGCACAGATCTGAAACCAAGTTTTATTAAG
                        *** *  *  *  ****   ** ****** *

Thanks. I'll get back to you this weekend, God's will.

 

[nPeace]

This is not true. The vast majority of mutations are neutral. Only a small minority are beneficial or harmful.

Well this article needs to change, if you are right.
...the vast majority of mutations are either neutral or harmful.

What do you even mean by "awareness and mutation being harmonized?"


What exactly do you want me to explain? What do you think prevents these things arising through mutation?


I really don't understand what you think this is saying. What makes you think this process doesn't involve genetic mutation?

Why do you always switch my questions to one of your questions?
I have seen this numerous times with you.

 

[Polymath257]

Well this article needs to change, if you are right.
...the vast majority of mutations are either neutral or harmful.

No, it does not. In fact, the vast majority of mutations are neutral. That implies the vast majority are neutral or harmful, doesn't it? It also implies that few are either beneficial or harmful, doesn't it?

|<beneficial>|<......................................................neutral............................................>|<...harmful>|

Why do you always switch my questions to one of your questions?
I have seen this numerous times with you.

Well, if it was clear what you are asking, we wouldn't have to do that. Many times, your questions are too vague to answer without further clarification.

Often the question itself shows a lack of basic understanding and we are trying to figure out why you think the question even makes sense.

 

[nPeace]

No, it does not. In fact, the vast majority of mutations are neutral. That implies the vast majority are neutral or harmful, doesn't it? It also implies that few are either beneficial or harmful, doesn't it?

|<beneficial>|<......................................................neutral............................................>|<...harmful>|

I don't know what you mean by few. Whether the vast majority of neutral in comparison to the harmful, are great, is irrelevant.

The article did not say neutral or beneficial, implying vast majority being neutral with little beneficial.
The article did not say neutral or harmful, implying vast majority being neutral with little harmful.
Circumstances differ.
It specifically said the vast majority are either neutral or harmful.
That does not mean equal parts, but it is stating this in contrast to beneficial mutations. (This from the context)
The point nonetheless is that this is a contradiction... The vast majority of mutations are neutral. Only a small minority are beneficial or harmful.
If I were the one saying it, I would be on the hammering end of your "fist", wouldn't I?
No worries, we know how it is.

Though circumstances vary, it is said...
This means that there are 10 million fatal point mutations and only 100 or 200 beneficial ones, for a ratio of about 50,000 to 100,000 fatal mutations for every beneficial one.

So for a typical set of 200 mutations, 190 will be neutral, 5 will be fatal, 4 will be harmful but not fatal, and 1 will be beneficial. Of course, if the figures are different, our calculations can be modified accordingly. If anyone has better estimates, I would appreciate learning about them. One evolutionary source said that these ratios are unknown and variable. If this is so, when more information is gained, better calculations can be done. Another evolutionary source gave figures much as I have given them. Sir Julian Huxley estimated that perhaps less than one-tenth of one percent of all mutations could be advantageous to an organism. It is interesting that over 1000 mutations of the fruit fly have been studied and all are visible and none are beneficial. (A few are slightly beneficial under artificial conditions, but all appear to be disadvantageous in nature.) Since it is known that most visible mutations are fatal, this implies a ratio of fatal to beneficial mutations of at least 500 to 1, much more severe than I am using.

Well, if it was clear what you are asking, we wouldn't have to do that. Many times, your questions are too vague to answer without further clarification.

Often the question itself shows a lack of basic understanding and we are trying to figure out why you think the question even makes sense.

No. I don't think that is it.
A case in point...

ImmortalFlame
Okay then. Do you have any examples of a complex organ which could not possibly has formed by numerous, successive, slight modifications?

nPeace
Can you describe how the cell formed, please?

ImmortalFlame
Why can't you answer the question?

nPeace
Well I think I did.
Did you not ask, "Do you have any examples of a complex organ which could not possibly has formed by numerous, successive, slight modifications?"
So it seem obvious to me that if I ask you if you can describe how the cell formed, my answer must be... the cell has not been demonstrated to have "formed by numerous, successive, slight modifications".
So can you answer my question, please?

ImmortalFlame
Asking a question is not answering a question. I'm asking YOU for something DEMONSTRATED TO HAVE NOT been produced by successive, slight modifications. Can you do that?

I though that was classic.
I think the problem lies in the fact that there are too many teachers on RF, interested only in teaching others - the "uneducated", and so they try to treat others like children. "ANSWER ME."
If we don't understand what someone is saying, we ask, and try to understand, not try to maneuver into a position where we become the sole questioner, while avoiding answering (the teacher's role).
This is a debate forum.